ID: 1135959551

View in Genome Browser
Species Human (GRCh38)
Location 16:26984394-26984416
Sequence AGCAGGCAGAGTAACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135959551_1135959554 -4 Left 1135959551 16:26984394-26984416 CCTTCCATGTTACTCTGCCTGCT No data
Right 1135959554 16:26984413-26984435 TGCTTTTATCCTAGCTGCCCTGG 0: 5
1: 31
2: 87
3: 206
4: 539
1135959551_1135959560 29 Left 1135959551 16:26984394-26984416 CCTTCCATGTTACTCTGCCTGCT No data
Right 1135959560 16:26984446-26984468 GATGGTGCCCACCGAGATGGAGG No data
1135959551_1135959556 11 Left 1135959551 16:26984394-26984416 CCTTCCATGTTACTCTGCCTGCT No data
Right 1135959556 16:26984428-26984450 TGCCCTGGTAGCTGATTAGATGG No data
1135959551_1135959559 26 Left 1135959551 16:26984394-26984416 CCTTCCATGTTACTCTGCCTGCT No data
Right 1135959559 16:26984443-26984465 TTAGATGGTGCCCACCGAGATGG No data
1135959551_1135959561 30 Left 1135959551 16:26984394-26984416 CCTTCCATGTTACTCTGCCTGCT No data
Right 1135959561 16:26984447-26984469 ATGGTGCCCACCGAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135959551 Original CRISPR AGCAGGCAGAGTAACATGGA AGG (reversed) Intergenic
No off target data available for this crispr