ID: 1135962063

View in Genome Browser
Species Human (GRCh38)
Location 16:27003322-27003344
Sequence TTGACACCTGGTGGGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135962063_1135962072 -8 Left 1135962063 16:27003322-27003344 CCCACCCTCCCACCAGGTGTCAA No data
Right 1135962072 16:27003337-27003359 GGTGTCAACAGAGGCCAACTGGG No data
1135962063_1135962071 -9 Left 1135962063 16:27003322-27003344 CCCACCCTCCCACCAGGTGTCAA No data
Right 1135962071 16:27003336-27003358 AGGTGTCAACAGAGGCCAACTGG No data
1135962063_1135962076 29 Left 1135962063 16:27003322-27003344 CCCACCCTCCCACCAGGTGTCAA No data
Right 1135962076 16:27003374-27003396 GCTTCCACCTGGTAGTAATTAGG No data
1135962063_1135962075 18 Left 1135962063 16:27003322-27003344 CCCACCCTCCCACCAGGTGTCAA No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135962063 Original CRISPR TTGACACCTGGTGGGAGGGT GGG (reversed) Intergenic
No off target data available for this crispr