ID: 1135962069

View in Genome Browser
Species Human (GRCh38)
Location 16:27003331-27003353
Sequence TGGCCTCTGTTGACACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135962069_1135962075 9 Left 1135962069 16:27003331-27003353 CCACCAGGTGTCAACAGAGGCCA No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962069_1135962076 20 Left 1135962069 16:27003331-27003353 CCACCAGGTGTCAACAGAGGCCA No data
Right 1135962076 16:27003374-27003396 GCTTCCACCTGGTAGTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135962069 Original CRISPR TGGCCTCTGTTGACACCTGG TGG (reversed) Intergenic
No off target data available for this crispr