ID: 1135962070

View in Genome Browser
Species Human (GRCh38)
Location 16:27003334-27003356
Sequence AGTTGGCCTCTGTTGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135962070_1135962075 6 Left 1135962070 16:27003334-27003356 CCAGGTGTCAACAGAGGCCAACT No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962070_1135962076 17 Left 1135962070 16:27003334-27003356 CCAGGTGTCAACAGAGGCCAACT No data
Right 1135962076 16:27003374-27003396 GCTTCCACCTGGTAGTAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135962070 Original CRISPR AGTTGGCCTCTGTTGACACC TGG (reversed) Intergenic
No off target data available for this crispr