ID: 1135962075

View in Genome Browser
Species Human (GRCh38)
Location 16:27003363-27003385
Sequence CCTAAACTTCTGCTTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135962070_1135962075 6 Left 1135962070 16:27003334-27003356 CCAGGTGTCAACAGAGGCCAACT No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962065_1135962075 14 Left 1135962065 16:27003326-27003348 CCCTCCCACCAGGTGTCAACAGA No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962066_1135962075 13 Left 1135962066 16:27003327-27003349 CCTCCCACCAGGTGTCAACAGAG No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962068_1135962075 10 Left 1135962068 16:27003330-27003352 CCCACCAGGTGTCAACAGAGGCC No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962069_1135962075 9 Left 1135962069 16:27003331-27003353 CCACCAGGTGTCAACAGAGGCCA No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962063_1135962075 18 Left 1135962063 16:27003322-27003344 CCCACCCTCCCACCAGGTGTCAA No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data
1135962064_1135962075 17 Left 1135962064 16:27003323-27003345 CCACCCTCCCACCAGGTGTCAAC No data
Right 1135962075 16:27003363-27003385 CCTAAACTTCTGCTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135962075 Original CRISPR CCTAAACTTCTGCTTCCACC TGG Intergenic
No off target data available for this crispr