ID: 1135962676

View in Genome Browser
Species Human (GRCh38)
Location 16:27010791-27010813
Sequence TGCCCCTTGCTGAAACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135962676_1135962678 8 Left 1135962676 16:27010791-27010813 CCAGTGAGTTTCAGCAAGGGGCA No data
Right 1135962678 16:27010822-27010844 AGCAATGCCTTGTGATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135962676 Original CRISPR TGCCCCTTGCTGAAACTCAC TGG (reversed) Intergenic
No off target data available for this crispr