ID: 1135964771

View in Genome Browser
Species Human (GRCh38)
Location 16:27026739-27026761
Sequence CACAGCTCCCAACTTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135964769_1135964771 6 Left 1135964769 16:27026710-27026732 CCAGGGGACAGAGTGGTGGGCAA No data
Right 1135964771 16:27026739-27026761 CACAGCTCCCAACTTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135964771 Original CRISPR CACAGCTCCCAACTTCATGA AGG Intergenic
No off target data available for this crispr