ID: 1135965827

View in Genome Browser
Species Human (GRCh38)
Location 16:27034232-27034254
Sequence CCTCAGACACACCCATGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135965827_1135965834 26 Left 1135965827 16:27034232-27034254 CCCATGCATGGGTGTGTCTGAGG No data
Right 1135965834 16:27034281-27034303 TGCCAAGTGTTCTCTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135965827 Original CRISPR CCTCAGACACACCCATGCAT GGG (reversed) Intergenic
No off target data available for this crispr