ID: 1135968083

View in Genome Browser
Species Human (GRCh38)
Location 16:27052180-27052202
Sequence GAGCCGAATCACTGCCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135968079_1135968083 -4 Left 1135968079 16:27052161-27052183 CCTGCCCGGAGAATGCCGGGAGC No data
Right 1135968083 16:27052180-27052202 GAGCCGAATCACTGCCGTGCTGG No data
1135968081_1135968083 -9 Left 1135968081 16:27052166-27052188 CCGGAGAATGCCGGGAGCCGAAT No data
Right 1135968083 16:27052180-27052202 GAGCCGAATCACTGCCGTGCTGG No data
1135968080_1135968083 -8 Left 1135968080 16:27052165-27052187 CCCGGAGAATGCCGGGAGCCGAA No data
Right 1135968083 16:27052180-27052202 GAGCCGAATCACTGCCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135968083 Original CRISPR GAGCCGAATCACTGCCGTGC TGG Intergenic
No off target data available for this crispr