ID: 1135969188

View in Genome Browser
Species Human (GRCh38)
Location 16:27060064-27060086
Sequence CTGCAGGCCCGCTTCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135969181_1135969188 -2 Left 1135969181 16:27060043-27060065 CCATTAGGGTCGGGCAGCACCCT No data
Right 1135969188 16:27060064-27060086 CTGCAGGCCCGCTTCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135969188 Original CRISPR CTGCAGGCCCGCTTCGGGGC AGG Intergenic