ID: 1135970456

View in Genome Browser
Species Human (GRCh38)
Location 16:27068411-27068433
Sequence GGCCAGGATGAAGTTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135970456 Original CRISPR GGCCAGGATGAAGTTTCATG TGG (reversed) Intergenic
900562965 1:3316985-3317007 GGCCAGGAAGCAGTGACATGGGG + Intronic
900596625 1:3482970-3482992 GGACAGGCTGAGGTTCCATGAGG - Intergenic
900745042 1:4355309-4355331 GGAGAGGATGAAGTTCCATCAGG + Intergenic
903641036 1:24860748-24860770 GGAGAGGAAGAAGTTTCAGGTGG - Intergenic
904273634 1:29366493-29366515 GGTCAGGATGAAGGGTCCTGGGG + Intergenic
906777087 1:48539515-48539537 GGCCAGGATTATCTTTCCTGCGG + Intronic
907589645 1:55654037-55654059 GGCCAGGATGAAACATGATGGGG + Intergenic
910626249 1:89311244-89311266 GTCCTGAATGAAGGTTCATGTGG - Intergenic
911216681 1:95202547-95202569 GGCCAGGATGAAATCAGATGGGG + Intronic
912432035 1:109633058-109633080 GGCCAGGATGAATTGGCAAGGGG - Intergenic
913285827 1:117225432-117225454 GGCCTGGAGGAAGGTTCATATGG + Intergenic
914810678 1:151025509-151025531 GTCCAGGATGATGGTTCCTGTGG - Exonic
916994082 1:170276926-170276948 CGCCACGATTAAGTTTCCTGAGG + Intergenic
917969183 1:180196400-180196422 GTCCAGGATGATGTTGCTTGGGG - Exonic
918260619 1:182792298-182792320 AGCCAGGATGCAGATCCATGAGG + Intronic
918573922 1:186032602-186032624 GGCCATGATTATGTTTCCTGAGG + Intronic
919165629 1:193887931-193887953 CGCCACGATTAAGTTTCCTGAGG + Intergenic
921761789 1:218923506-218923528 GGGCAGGATGGAGTAGCATGAGG - Intergenic
924068855 1:240254864-240254886 GGCCAGGATGCAGTCTGGTGGGG + Intronic
1063755784 10:9006475-9006497 GGCCTGGATGATGTATCATAAGG + Intergenic
1069367450 10:67709508-67709530 GGCCTAGATGAAGTTTCAGAAGG - Intergenic
1069556227 10:69400317-69400339 GGCCAGGCTGAAGATGCTTGTGG - Intronic
1069771235 10:70901684-70901706 GGCCAGTTTCAAGGTTCATGAGG - Intergenic
1072304753 10:94096401-94096423 TGCTATGATTAAGTTTCATGAGG - Intronic
1072997530 10:100258787-100258809 GGCCAAGATGAACTATGATGGGG + Intronic
1073136988 10:101225645-101225667 GGCCAGGCTGAATTTCAATGTGG - Intergenic
1076168494 10:128301267-128301289 GGCCAGGGTGATGTGTCATGAGG + Intergenic
1078334404 11:10451975-10451997 GGCCTGGCTGCAGCTTCATGGGG + Intronic
1079104528 11:17561728-17561750 GGCCAGGATGTACTGACATGTGG - Exonic
1079567786 11:21904079-21904101 GGCCATGAATAAGTTTCCTGAGG - Intergenic
1080727365 11:34911860-34911882 GGAAAGGATGAAGTTCCATTAGG - Intronic
1083500751 11:63105412-63105434 GTCCAGGAAGAAGTTTTCTGTGG - Intronic
1083796364 11:65019022-65019044 GGCCAGTATGAAGCTTCGAGAGG + Intronic
1089022518 11:115231054-115231076 GGCTAGGAAAAATTTTCATGAGG - Intronic
1091382575 12:71871-71893 GGCCAGGATGAAGGCTCACTGGG + Intronic
1091620888 12:2088060-2088082 GAACAGGATGAATTTTCAGGAGG + Intronic
1093077922 12:14776033-14776055 AGCCAGGATGAAATTTGCTGAGG - Intronic
1093167523 12:15822102-15822124 AGCAAGGCTGATGTTTCATGAGG + Intronic
1095202670 12:39402679-39402701 GCCCAGGATGACTTTGCATGTGG + Intronic
1099526778 12:83726487-83726509 GTCCAGGCAGAAGTTTGATGTGG + Intergenic
1101551472 12:105766466-105766488 GGCCAGGGAGAAGCTTCCTGTGG - Intergenic
1104500612 12:129282069-129282091 GGCTGGGATGAGGTTTCTTGTGG - Intronic
1106825968 13:33520767-33520789 GGCGAGGAAGAAGTTACATGAGG + Intergenic
1107985988 13:45776571-45776593 GGCCAGCATGAATATTCATGAGG - Intergenic
1109210420 13:59528945-59528967 GCCCAGGCTGAAATTACATGTGG - Intergenic
1110184238 13:72654801-72654823 GGACAGGTTGCAGTCTCATGGGG - Intergenic
1110322496 13:74175868-74175890 GGCAAGGATGATGTGTTATGAGG - Intergenic
1112972767 13:105281259-105281281 ATCGAGTATGAAGTTTCATGTGG - Intergenic
1113638347 13:111937812-111937834 GGCCTGGAGGAAGTTGCATTGGG - Intergenic
1113648210 13:112013772-112013794 GGCCATGATGAAGTCAAATGAGG + Intergenic
1113748270 13:112761186-112761208 GGCCATGATGAAGTCAAATGAGG - Intronic
1115233785 14:31188869-31188891 GGCCAGGATGAAGTTGTGTATGG - Intronic
1116622827 14:47227402-47227424 AGCCAGGATGTGGTTTCACGAGG - Intronic
1120684221 14:87518884-87518906 TGCCATGATTAAGTTTCCTGAGG + Intergenic
1122098107 14:99386360-99386382 GGCCAGGAGCAGGTTTCCTGGGG - Intergenic
1124595774 15:31090336-31090358 CCCCAGGATGCAGTTTCATATGG - Intronic
1125510252 15:40288867-40288889 GGCCAGGATGAAGGGTCTGGAGG - Exonic
1129019514 15:72503845-72503867 TGGCAGGAGCAAGTTTCATGTGG + Intronic
1132016297 15:98320436-98320458 TGTCAGGATGAAGCTTCTTGCGG - Intergenic
1133598201 16:7313098-7313120 GGCCCGGATGAAGAGTGATGTGG - Intronic
1135867350 16:26116135-26116157 GGGCAGGATTCAGTTTCATTTGG + Intronic
1135970456 16:27068411-27068433 GGCCAGGATGAAGTTTCATGTGG - Intergenic
1136859314 16:33687663-33687685 GCGCAGGATGCATTTTCATGCGG - Intergenic
1141562515 16:84878970-84878992 GCCCAGGATGAGGGCTCATGAGG - Intronic
1203120822 16_KI270728v1_random:1535850-1535872 GCGCAGGATGCATTTTCATGCGG - Intergenic
1144412443 17:15014208-15014230 GTGCACGATGAAGTTTCAAGAGG + Intergenic
1144563420 17:16340580-16340602 AGCCAGGCTGAAGCTGCATGTGG - Intronic
1145359693 17:22202034-22202056 AGCCAGGCTGAAGCTGCATGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147566226 17:41537891-41537913 GGTCAGGCTGACGATTCATGGGG + Intergenic
1148349871 17:46933258-46933280 GACCAGGAAGAAGTTTCATCTGG - Intronic
1148451754 17:47783035-47783057 CTCCAGGATGAAGACTCATGGGG + Intergenic
1148994500 17:51697844-51697866 TTCCAGGATGAAGTATCCTGGGG - Intronic
1149642780 17:58214914-58214936 GTCCTGGATGAGGTTTCAGGAGG - Intronic
1150959370 17:69897161-69897183 GGCCAGGCTGCATTTTCATCTGG + Intergenic
1152622537 17:81372487-81372509 GGACAGGATGGAGCTTCAGGAGG - Intergenic
1153574055 18:6503184-6503206 TGCCATGATTAAGTTTCCTGAGG + Intergenic
1153692071 18:7603860-7603882 GGCCAGGATCAATTTTCAGTGGG + Intronic
1155828880 18:30486380-30486402 GACCAGGATGTAGGTTGATGAGG + Intergenic
1157900809 18:51514971-51514993 TGACAGGATTCAGTTTCATGCGG - Intergenic
1161401000 19:4066210-4066232 GGCCAGGATTGAGCTCCATGGGG - Intronic
1166852133 19:45766095-45766117 GGCCAGGAGGAAGTTTCCTGTGG + Exonic
925268354 2:2583270-2583292 GGCCAGGTTGCAGCTTTATGGGG + Intergenic
925568462 2:5283007-5283029 GGCCAGAAGAAAGCTTCATGAGG + Intergenic
927418647 2:22906336-22906358 CCCCAGGATGAAGTTCCATGAGG - Intergenic
927719715 2:25374835-25374857 GGCCTGGATGTTGTTTCGTGTGG + Intergenic
928243155 2:29604032-29604054 GGCTAGGATCAAGTTAAATGTGG + Intronic
929812239 2:45200596-45200618 GGACAGGATGCAGTCTGATGGGG - Intergenic
933580632 2:84122773-84122795 GACCAGAAGGAAGATTCATGTGG - Intergenic
934136433 2:89000487-89000509 GGTCAGAGTGAAGTCTCATGGGG + Intergenic
934689255 2:96345687-96345709 GGACATGGTGAAGTGTCATGAGG + Intronic
934990090 2:98914666-98914688 GGCCAGCGTGAAGCTCCATGAGG - Intronic
935702698 2:105826135-105826157 TGCCATGATTAAGTTTCCTGAGG - Intronic
938812987 2:134870781-134870803 GGCAAGTAGGAAGTTTCACGTGG + Intronic
939712235 2:145536672-145536694 GGCCAGGAGGATGGTTCCTGTGG - Intergenic
941861237 2:170283066-170283088 GGCTAGGATGCAGTTTGGTGGGG + Intronic
943223625 2:185141035-185141057 TGCCATGATTAAGTTTCCTGAGG - Intergenic
943292965 2:186099041-186099063 GGTCAGGATTAAAATTCATGTGG + Intergenic
944344589 2:198646804-198646826 GACCAGGATAAAGTTCCAGGAGG + Intergenic
944914099 2:204340154-204340176 GGCCAGGATGTACTTTCATTTGG - Intergenic
945967482 2:216204173-216204195 TGCCAGGATGATGTTTCTTTTGG + Intronic
947338881 2:229116368-229116390 GGGCAGGATGAAGTGCCATGAGG - Intronic
1169634531 20:7674019-7674041 AGCCTTGATGATGTTTCATGTGG - Intergenic
1170453792 20:16513358-16513380 GGCCAGCATGGATTTTAATGTGG - Intronic
1170993175 20:21324015-21324037 GGACAGGATGAAGGTGGATGTGG + Intronic
1172026491 20:31952297-31952319 CACTAGGATGAAGTTCCATGAGG - Intergenic
1172490866 20:35336634-35336656 GGCCAGAAATCAGTTTCATGGGG - Intronic
1173104737 20:40123242-40123264 TGCCACCATGAAGTTTGATGGGG - Intergenic
1173910889 20:46669950-46669972 GGCCAGCATGAAGTTTTATATGG - Intronic
1175927384 20:62477613-62477635 TGCAAGGAAGAACTTTCATGCGG - Intergenic
1176282628 20:64322964-64322986 GGCCAGGATGAAGGCTCACTGGG - Intergenic
1176687313 21:9862406-9862428 GTCCAGGAAGAAGTTTACTGTGG + Intergenic
1179438421 21:41377509-41377531 AGCCAGGAAGAAGTTCCAAGAGG - Intronic
1181308636 22:21931353-21931375 GGGCAGGATGAAGCTTCCGGGGG + Intronic
1181446963 22:22984437-22984459 AGCCAGGAAGAAGTTTCCTATGG - Intergenic
1181460734 22:23084565-23084587 GGCCAGGATGAAGCAGCATGGGG + Intronic
949273297 3:2246773-2246795 GGCATAGATGAAGTTTGATGGGG + Intronic
950098952 3:10345755-10345777 GGCCAGGGTGAGGCTTCCTGAGG - Intronic
953018242 3:39098194-39098216 GCCCATGATGACATTTCATGAGG - Exonic
953766187 3:45745722-45745744 TGCCATGATGAAGTTTTGTGAGG + Intergenic
954447064 3:50552513-50552535 GGTCAGGATGAGGCTTCCTGGGG + Intergenic
957494201 3:80969576-80969598 GGGCAAGATGCAGTCTCATGCGG + Intergenic
957582455 3:82091858-82091880 GGCCAGGTTGAATTTTCACCTGG - Intergenic
957692992 3:83596332-83596354 GGCCAGGCAGAAGTTTGCTGTGG + Intergenic
960047694 3:113212867-113212889 ACCCAGGAAGAATTTTCATGGGG + Intronic
960407693 3:117282284-117282306 GTCCAGGAAGAAGTTTGATAAGG + Intergenic
960473726 3:118098384-118098406 GGCCAGTATTAACTTTCATGAGG + Intergenic
962334229 3:134511644-134511666 TGCCATGATTAAGTTTCCTGAGG - Intronic
963083880 3:141419107-141419129 TGCCATGATTAAGTTTCCTGAGG - Intronic
965768133 3:172153136-172153158 AGCCACGATGAAGTTTGATTTGG + Intronic
968927582 4:3557889-3557911 GGCCAGGGGGAAGTTTGATAGGG - Intergenic
971594482 4:28511144-28511166 GCCCAGGGTGAATTTTTATGGGG + Intergenic
972366656 4:38382113-38382135 GACCAAGCTGAAGTTCCATGTGG + Intergenic
974135046 4:57805004-57805026 GTTCAGGAAGAATTTTCATGAGG + Intergenic
978076602 4:104538955-104538977 GGCAAGTATGAAGTTTAAGGAGG - Intergenic
978566891 4:110092355-110092377 GGCCTGTAAGAAGTTTCATATGG + Intronic
985297922 4:188455452-188455474 GACCAGAATGAAGATTCTTGGGG + Intergenic
985944132 5:3163578-3163600 GTCCATGCTCAAGTTTCATGGGG + Intergenic
988637074 5:32996090-32996112 TGCCAAGATGAGGTATCATGTGG + Intergenic
989657760 5:43762393-43762415 GGGCAGGAGGCAGTGTCATGAGG - Intergenic
991301052 5:65129470-65129492 GGCCAAGAAGTAGCTTCATGAGG - Intergenic
991670389 5:69041436-69041458 GGCTAGGATGTAGTTTGTTGGGG - Intergenic
993389803 5:87305569-87305591 GGCCTGGGCAAAGTTTCATGAGG + Intronic
993827419 5:92709003-92709025 GGACAGGTGGAAGTTTCCTGTGG + Intergenic
994648518 5:102498792-102498814 AGCCAGGATGAAGTCTCAAGGGG - Exonic
995211969 5:109550989-109551011 GTCCAGGCTGAGGTTTCAGGTGG + Intergenic
996889935 5:128406546-128406568 GGCCATGATGAAGTATAATAAGG + Intronic
997446860 5:133946739-133946761 GGCCAGGGTGAACATTTATGGGG - Intergenic
1002183584 5:177443644-177443666 GGCCAGGAACAAGCTTGATGGGG - Intergenic
1006112112 6:31753768-31753790 GCCCAGGCTGAAGTGCCATGGGG + Intronic
1007278061 6:40690151-40690173 TGCCAGGAGGAAGCTCCATGTGG - Intergenic
1007297329 6:40834873-40834895 CCCCAGGATGAATTATCATGTGG + Intergenic
1010659623 6:78555375-78555397 TGCCATGATTAAGTTTCCTGAGG - Intergenic
1011651865 6:89514033-89514055 GCCCAGGATGGCTTTTCATGTGG + Intronic
1013692561 6:112663156-112663178 GGCCAGGATGTATTATCCTGGGG + Intergenic
1015139317 6:129911790-129911812 GGCCAGGCTGAATTTTGAGGGGG + Intergenic
1015618103 6:135100707-135100729 GGCCAGGCTGGAGTGTAATGGGG + Intronic
1017105649 6:150885100-150885122 GGCCAGGGTGAAGTTTCCTAAGG + Intronic
1019853755 7:3584376-3584398 GTCCAGAATGAAGGGTCATGTGG - Intronic
1021298075 7:18934305-18934327 GGCCATAATGAATTTTGATGTGG - Intronic
1022862522 7:34382957-34382979 GTCCAGGAAGAAGTTTGCTGTGG + Intergenic
1023689536 7:42772172-42772194 GGCCAGGCTGAAGGCTCATCAGG - Intergenic
1023862528 7:44224984-44225006 GGGCAGGATGGAGATTCGTGTGG - Intronic
1027782336 7:82534939-82534961 AGCCAGGCTGAACTTTCATCTGG - Intergenic
1030579002 7:111328786-111328808 GGGCACGTTGAAGTTTCATGTGG - Intronic
1033991060 7:147287582-147287604 GGGCAAGATGAAGTTACCTGGGG - Intronic
1035109719 7:156470983-156471005 TGCCATGATGATGTTTCCTGAGG + Intergenic
1036701763 8:11017823-11017845 GGCCAGGAAGCAGTTTTGTGGGG + Intronic
1036933681 8:12980205-12980227 GGCAAGGAGGAATTTTCCTGTGG - Intronic
1037819765 8:22130028-22130050 CGCCAGGCTGAAGTTTCCAGCGG - Intronic
1037829349 8:22178791-22178813 GGCCAGGAAGGAGTTTGAGGAGG - Intronic
1038179394 8:25212440-25212462 GGCCACGGGCAAGTTTCATGTGG + Intronic
1038310713 8:26444302-26444324 GGCCAGGATCAGGTGTCAGGAGG + Intronic
1040416244 8:47198358-47198380 GGCCAGGGTGAAGTCCCTTGGGG + Intergenic
1041265608 8:56061240-56061262 CGCCATGATTAAGTTTCCTGAGG + Intergenic
1042193431 8:66211327-66211349 TGCCATGATTAAGTTTCCTGAGG - Intergenic
1042658093 8:71122901-71122923 ACCCAGGATGTAGTTTCTTGAGG + Intergenic
1043806536 8:84679193-84679215 GGCAGGGATGAAATTTGATGTGG + Intronic
1048399788 8:134054043-134054065 TGCCAGGATAAAGTTTCGTAGGG + Intergenic
1048957927 8:139552232-139552254 TGCCATGATTAAGTTTCCTGAGG - Intergenic
1049407875 8:142459840-142459862 GGCCAGGAGGAAGGTCAATGTGG - Intronic
1052571332 9:30227918-30227940 TGCCATGATTAAGTTTCCTGAGG + Intergenic
1052787753 9:32845497-32845519 GTCCATGTTGAAGTTTCAAGTGG - Intergenic
1053781990 9:41619195-41619217 GTCCAGGAAGAAGTTTGCTGTGG - Intergenic
1053802439 9:41772968-41772990 GGCCAGGGGGAAGTTTGATAGGG - Intergenic
1054142799 9:61542102-61542124 GGCCAGGGGGAAGTTTGATAGGG + Intergenic
1054169941 9:61829349-61829371 GTCCAGGAAGAAGTTTGCTGTGG - Intergenic
1054190748 9:61984314-61984336 GGCCAGGGGGAAGTTTGATAGGG - Intergenic
1054462545 9:65473252-65473274 GGCCAGGGTGAAGTTTGATAGGG + Intergenic
1054647626 9:67603403-67603425 GGCCAGGGGGAAGTTTGATAGGG + Intergenic
1054667597 9:67751466-67751488 GTCCAGGAAGAAGTTTGCTGTGG + Intergenic
1055424518 9:76180568-76180590 GGTCAGGATGAACTCTGATGGGG - Intronic
1060171958 9:121469155-121469177 GGCCAGGAAGTACTTTAATGTGG + Intergenic
1061144805 9:128791411-128791433 GGCCAGGATGGAGGTCCATGAGG - Exonic
1062437484 9:136552968-136552990 GCCCAGGCTGGAGTGTCATGGGG + Intergenic
1062471003 9:136704432-136704454 TGCCACGATGATGTTTCCTGAGG - Intergenic
1186150689 X:6671836-6671858 GGCAAGGTTGATGTTTTATGTGG + Intergenic
1189729440 X:44003693-44003715 GGCCTGAGTGAAGATTCATGAGG - Intergenic
1190060123 X:47205447-47205469 GGCCAGGATGATGATGCATGTGG - Intronic
1192347773 X:70325731-70325753 GGCCAGGGGGAGGTTTGATGGGG - Intronic
1193786148 X:85761349-85761371 ATCCAGAATAAAGTTTCATGTGG + Intergenic
1193837455 X:86362221-86362243 GACCAGGATGAAGATGAATGAGG + Intronic
1194446408 X:93992623-93992645 AGCCAGCATGTGGTTTCATGTGG + Intergenic
1197167348 X:123392384-123392406 GGTCAGGATGTAGTCTGATGGGG + Intronic