ID: 1135971579

View in Genome Browser
Species Human (GRCh38)
Location 16:27075702-27075724
Sequence ACTGAAGGCTGGAACCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135971579_1135971583 -7 Left 1135971579 16:27075702-27075724 CCACCAAGGTTCCAGCCTTCAGT No data
Right 1135971583 16:27075718-27075740 CTTCAGTGACTGCTATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135971579 Original CRISPR ACTGAAGGCTGGAACCTTGG TGG (reversed) Intergenic
No off target data available for this crispr