ID: 1135973008

View in Genome Browser
Species Human (GRCh38)
Location 16:27085982-27086004
Sequence TTTCCATTATACCACTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135973008_1135973019 15 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973019 16:27086020-27086042 GTGGAGGGTGGGAGGGGAGCAGG No data
1135973008_1135973014 3 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973014 16:27086008-27086030 GAGACTCAGAAGGTGGAGGGTGG No data
1135973008_1135973013 0 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG No data
1135973008_1135973016 7 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973016 16:27086012-27086034 CTCAGAAGGTGGAGGGTGGGAGG No data
1135973008_1135973015 4 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973015 16:27086009-27086031 AGACTCAGAAGGTGGAGGGTGGG No data
1135973008_1135973011 -4 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973011 16:27086001-27086023 GAAACTGGAGACTCAGAAGGTGG No data
1135973008_1135973010 -7 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973010 16:27085998-27086020 ATGGAAACTGGAGACTCAGAAGG No data
1135973008_1135973018 9 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973018 16:27086014-27086036 CAGAAGGTGGAGGGTGGGAGGGG No data
1135973008_1135973017 8 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973017 16:27086013-27086035 TCAGAAGGTGGAGGGTGGGAGGG No data
1135973008_1135973012 -1 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973012 16:27086004-27086026 ACTGGAGACTCAGAAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135973008 Original CRISPR TTTCCATTATACCACTCTGT AGG (reversed) Intergenic
No off target data available for this crispr