ID: 1135973013

View in Genome Browser
Species Human (GRCh38)
Location 16:27086005-27086027
Sequence CTGGAGACTCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135973008_1135973013 0 Left 1135973008 16:27085982-27086004 CCTACAGAGTGGTATAATGGAAA No data
Right 1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135973013 Original CRISPR CTGGAGACTCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr