ID: 1135976113

View in Genome Browser
Species Human (GRCh38)
Location 16:27109841-27109863
Sequence GATGCGCGGCACTGCAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135976104_1135976113 -3 Left 1135976104 16:27109821-27109843 CCCTGCTGCCCCCCAGCGGCGAT No data
Right 1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG No data
1135976097_1135976113 22 Left 1135976097 16:27109796-27109818 CCGACGGGACTTGGCCTCCGCGG No data
Right 1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG No data
1135976101_1135976113 8 Left 1135976101 16:27109810-27109832 CCTCCGCGGGGCCCTGCTGCCCC No data
Right 1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG No data
1135976105_1135976113 -4 Left 1135976105 16:27109822-27109844 CCTGCTGCCCCCCAGCGGCGATG No data
Right 1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG No data
1135976102_1135976113 5 Left 1135976102 16:27109813-27109835 CCGCGGGGCCCTGCTGCCCCCCA No data
Right 1135976113 16:27109841-27109863 GATGCGCGGCACTGCAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135976113 Original CRISPR GATGCGCGGCACTGCAGAGG CGG Intergenic
No off target data available for this crispr