ID: 1135981441

View in Genome Browser
Species Human (GRCh38)
Location 16:27150624-27150646
Sequence AGTCATAAGGCTGGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135981441_1135981447 10 Left 1135981441 16:27150624-27150646 CCACCACGCCCAGCCTTATGACT No data
Right 1135981447 16:27150657-27150679 GGTCACTAACCTCATTAATGAGG No data
1135981441_1135981448 11 Left 1135981441 16:27150624-27150646 CCACCACGCCCAGCCTTATGACT No data
Right 1135981448 16:27150658-27150680 GTCACTAACCTCATTAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135981441 Original CRISPR AGTCATAAGGCTGGGCGTGG TGG (reversed) Intergenic
No off target data available for this crispr