ID: 1135983338

View in Genome Browser
Species Human (GRCh38)
Location 16:27165825-27165847
Sequence GCACCTCCTTGGTCTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135983338_1135983348 30 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983348 16:27165878-27165900 TCTCAGGCTCGTGAAAGTGCAGG No data
1135983338_1135983341 -3 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983341 16:27165845-27165867 TGCCCAGAATGGAAAATTTAAGG No data
1135983338_1135983345 14 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983345 16:27165862-27165884 TTAAGGAGGCCCTCACTCTCAGG No data
1135983338_1135983344 0 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983344 16:27165848-27165870 CCAGAATGGAAAATTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135983338 Original CRISPR GCACCTCCTTGGTCTCACCC TGG (reversed) Intergenic
No off target data available for this crispr