ID: 1135983341

View in Genome Browser
Species Human (GRCh38)
Location 16:27165845-27165867
Sequence TGCCCAGAATGGAAAATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135983335_1135983341 8 Left 1135983335 16:27165814-27165836 CCATTTTCTTGCCAGGGTGAGAC No data
Right 1135983341 16:27165845-27165867 TGCCCAGAATGGAAAATTTAAGG No data
1135983338_1135983341 -3 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983341 16:27165845-27165867 TGCCCAGAATGGAAAATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135983341 Original CRISPR TGCCCAGAATGGAAAATTTA AGG Intergenic
No off target data available for this crispr