ID: 1135983348

View in Genome Browser
Species Human (GRCh38)
Location 16:27165878-27165900
Sequence TCTCAGGCTCGTGAAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135983340_1135983348 19 Left 1135983340 16:27165836-27165858 CCAAGGAGGTGCCCAGAATGGAA No data
Right 1135983348 16:27165878-27165900 TCTCAGGCTCGTGAAAGTGCAGG No data
1135983338_1135983348 30 Left 1135983338 16:27165825-27165847 CCAGGGTGAGACCAAGGAGGTGC No data
Right 1135983348 16:27165878-27165900 TCTCAGGCTCGTGAAAGTGCAGG No data
1135983342_1135983348 8 Left 1135983342 16:27165847-27165869 CCCAGAATGGAAAATTTAAGGAG No data
Right 1135983348 16:27165878-27165900 TCTCAGGCTCGTGAAAGTGCAGG No data
1135983343_1135983348 7 Left 1135983343 16:27165848-27165870 CCAGAATGGAAAATTTAAGGAGG 0: 2
1: 0
2: 3
3: 30
4: 247
Right 1135983348 16:27165878-27165900 TCTCAGGCTCGTGAAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135983348 Original CRISPR TCTCAGGCTCGTGAAAGTGC AGG Intergenic
No off target data available for this crispr