ID: 1135983943

View in Genome Browser
Species Human (GRCh38)
Location 16:27169747-27169769
Sequence TCCCTACTGTTTCCAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135983943_1135983946 5 Left 1135983943 16:27169747-27169769 CCTCTGGCTGGAAACAGTAGGGA No data
Right 1135983946 16:27169775-27169797 TCTCCACTAGAGCAGTCTGGTGG No data
1135983943_1135983945 2 Left 1135983943 16:27169747-27169769 CCTCTGGCTGGAAACAGTAGGGA No data
Right 1135983945 16:27169772-27169794 GGCTCTCCACTAGAGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135983943 Original CRISPR TCCCTACTGTTTCCAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr