ID: 1135985518

View in Genome Browser
Species Human (GRCh38)
Location 16:27181013-27181035
Sequence GATTGAGACCAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135985512_1135985518 13 Left 1135985512 16:27180977-27180999 CCCAGCCAGGGGTATTTTGTTAC No data
Right 1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG No data
1135985513_1135985518 12 Left 1135985513 16:27180978-27181000 CCAGCCAGGGGTATTTTGTTACA No data
Right 1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG No data
1135985514_1135985518 8 Left 1135985514 16:27180982-27181004 CCAGGGGTATTTTGTTACAGCAG No data
Right 1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135985518 Original CRISPR GATTGAGACCAGAGGGCAGT GGG Intergenic
No off target data available for this crispr