ID: 1135988625

View in Genome Browser
Species Human (GRCh38)
Location 16:27203421-27203443
Sequence CTGTTTAAAAGGCCGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135988625_1135988638 10 Left 1135988625 16:27203421-27203443 CCATCCCCCGGCCTTTTAAACAG No data
Right 1135988638 16:27203454-27203476 GGGCCACGGCATCGATCACTCGG No data
1135988625_1135988637 -4 Left 1135988625 16:27203421-27203443 CCATCCCCCGGCCTTTTAAACAG No data
Right 1135988637 16:27203440-27203462 ACAGCAGTGGGGCGGGGCCACGG No data
1135988625_1135988640 22 Left 1135988625 16:27203421-27203443 CCATCCCCCGGCCTTTTAAACAG No data
Right 1135988640 16:27203466-27203488 CGATCACTCGGCGCTCCTCCAGG No data
1135988625_1135988636 -10 Left 1135988625 16:27203421-27203443 CCATCCCCCGGCCTTTTAAACAG No data
Right 1135988636 16:27203434-27203456 TTTTAAACAGCAGTGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135988625 Original CRISPR CTGTTTAAAAGGCCGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr