ID: 1135989152

View in Genome Browser
Species Human (GRCh38)
Location 16:27206885-27206907
Sequence CTGGGGAAACACTCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135989152_1135989160 15 Left 1135989152 16:27206885-27206907 CCAGCAAGAGAGTGTTTCCCCAG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1135989160 16:27206923-27206945 TTCTGTAAGGCCATTTTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 188
1135989152_1135989157 2 Left 1135989152 16:27206885-27206907 CCAGCAAGAGAGTGTTTCCCCAG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1135989157 16:27206910-27206932 AGACCAAGACTCCTTCTGTAAGG 0: 1
1: 0
2: 0
3: 20
4: 247
1135989152_1135989161 23 Left 1135989152 16:27206885-27206907 CCAGCAAGAGAGTGTTTCCCCAG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1135989161 16:27206931-27206953 GGCCATTTTGCATGGCTAACAGG 0: 1
1: 0
2: 2
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135989152 Original CRISPR CTGGGGAAACACTCTCTTGC TGG (reversed) Intronic
902417764 1:16251533-16251555 CTGGGGAAAGGCTCCCTTCCCGG + Exonic
904607646 1:31706740-31706762 CTGGGGAATCCCTGTCTGGCAGG + Intergenic
910123592 1:83816956-83816978 ATGGGGAAACACCTTCCTGCAGG + Intergenic
916170437 1:161997893-161997915 CTGGGGAAAGATGCTCCTGCTGG - Exonic
920706089 1:208251612-208251634 TTTGTGAAATACTCTCTTGCCGG + Intergenic
924430663 1:243993991-243994013 CTGGGGAAGCACTCTTTTCACGG + Intergenic
924706280 1:246505406-246505428 CTTGGGAAACTCACTGTTGCTGG - Intronic
1067319269 10:45202159-45202181 CTGGTGAAACACTATCTGGGGGG - Intergenic
1067565570 10:47334095-47334117 CAGAGGAAACACTCTCTTCTTGG + Intergenic
1068328700 10:55532226-55532248 ATCGGGAAACAGTCTCTTGAGGG + Intronic
1070098169 10:73358673-73358695 CTGAAGAAACTCTCTCTTCCCGG - Intronic
1072485355 10:95849462-95849484 CTTAGGAGAAACTCTCTTGCTGG - Intronic
1076717453 10:132373624-132373646 CTGGAGAAAGACTCTCTAGATGG - Intronic
1076822362 10:132945793-132945815 CTGGGCCAACATTCTCCTGCGGG - Intergenic
1080035224 11:27702388-27702410 TTTGAGAAACACTCTCTTGGGGG + Intronic
1083173037 11:60934224-60934246 CAGGGGAGACGCTCTCTTACGGG - Intronic
1084411653 11:69009416-69009438 CTGGGGCAACACTCTCGGGGTGG + Intronic
1085811653 11:79687926-79687948 TTGGGGAAAGACTCTCATGTTGG - Intergenic
1086345760 11:85894133-85894155 CTGGGGAAAAATTGTCTTCCAGG + Intronic
1090086234 11:123653772-123653794 CAGGGGAAACAATCTATTGAAGG + Exonic
1091488673 12:914451-914473 CTGGAGAAAGACTTCCTTGCAGG - Exonic
1092804581 12:12207838-12207860 ATGGGGTAACACTAACTTGCTGG + Intronic
1094389997 12:29938759-29938781 TTGGGGAAACTCTCTATTCCTGG + Intergenic
1096844682 12:54399644-54399666 CTGGGCCAAGACTTTCTTGCAGG - Exonic
1096980266 12:55724556-55724578 CTTGAAAAACAATCTCTTGCTGG - Exonic
1097897233 12:64837240-64837262 CTGTGGAAAAACTGTCTTCCCGG - Intronic
1105937895 13:25118894-25118916 TGGGGGAGACACTCTCTTACCGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113201034 13:107867479-107867501 CTGGAGAAACACTTTTTTGGGGG + Intergenic
1113226062 13:108160862-108160884 CTGGGGAATCACTCCCTCTCTGG + Intergenic
1114556886 14:23567336-23567358 GTGGAGAAACACTCTCTGGTCGG + Exonic
1115730999 14:36269890-36269912 CTGGAGAAAAACAATCTTGCAGG - Intergenic
1116093975 14:40344169-40344191 CTGGAGAAAGATTCACTTGCTGG - Intergenic
1117011319 14:51473411-51473433 CTGGAGAAACACTGTCTGCCAGG - Intergenic
1120069052 14:80082506-80082528 CTTCTGAAACACTCTCTTGGAGG - Intergenic
1120465493 14:84851825-84851847 CTGGGGAAACATTCTTTTTGAGG - Intergenic
1124088728 15:26577810-26577832 CTGGGGAGACAGCATCTTGCAGG + Intronic
1127994577 15:64145770-64145792 CTGGGGAAAGAATGTCTTGCAGG - Intronic
1130859722 15:87875398-87875420 CTGGGGAATCACTGCCTTCCTGG - Intronic
1134050829 16:11136065-11136087 CTGGGCAAATACTCTGCTGCTGG - Intronic
1135204572 16:20472313-20472335 CTGGGGAAGCCCTCTCTTCCTGG + Intronic
1135214316 16:20551498-20551520 CTGGGGAAGCCCTCTCTTCCTGG - Intronic
1135989152 16:27206885-27206907 CTGGGGAAACACTCTCTTGCTGG - Intronic
1136517679 16:30777736-30777758 GTGGGGAGACACTTTCTGGCTGG + Intergenic
1137700395 16:50493858-50493880 TTGGGGAAAGACTCTTTTTCTGG - Intergenic
1139667504 16:68468041-68468063 CTGCCGTAACACTCTCATGCTGG + Intergenic
1140306803 16:73810314-73810336 CTGATGAAACATTCTCTTTCAGG + Intergenic
1142218700 16:88842340-88842362 CTGGGGAGAGTCTCTCCTGCTGG - Intronic
1143265305 17:5632416-5632438 CTGGAGAAGCAGGCTCTTGCTGG + Intergenic
1143757902 17:9079943-9079965 CTGGGGAACCACTTCCTTGGTGG - Intronic
1144706318 17:17370776-17370798 CTGGGGAATCTCCCTCATGCTGG + Intergenic
1145993491 17:29092867-29092889 CTGGGCAATCTCTCGCTTGCTGG + Exonic
1147339561 17:39745570-39745592 CTGGGGACCCACTCTCTGGGTGG + Intronic
1147814683 17:43200476-43200498 CTGGGGAAAGACTCCCTGGAGGG + Exonic
1148033332 17:44638361-44638383 CTGTGGAAAAACTGTCTTCCAGG - Intergenic
1148212638 17:45817662-45817684 CTGGGGAGTCACTTTCTGGCTGG - Intronic
1150621061 17:66807979-66808001 CTGGCAAAACACTCTCTTGAGGG - Exonic
1151593533 17:75062841-75062863 GGTGCGAAACACTCTCTTGCTGG - Intronic
1152641539 17:81451463-81451485 CTGGGGAGACACTCCCTTGGTGG - Intronic
1153223061 18:2878733-2878755 CTGGGGAAACACCTCCTTTCTGG + Intronic
1157740808 18:50091058-50091080 CTGGGGGAATTCTCTCATGCTGG - Intronic
1159688082 18:71448661-71448683 CTGATGAAACAATCTCTTGGGGG - Intergenic
1164606331 19:29601061-29601083 CTGGTCAAACCCTCTCCTGCTGG - Intergenic
1165038286 19:33050215-33050237 CTAGGGAGACACTCTTCTGCTGG - Intronic
1166191058 19:41176965-41176987 CTGGGAAAACATTCTTTTGCAGG - Intergenic
1166950759 19:46426593-46426615 CTGGGGACAGCCTCTCTTGCTGG - Intergenic
926573851 2:14559120-14559142 CTGGGGAATCACTCTAGTGAAGG + Intergenic
927702257 2:25275999-25276021 CTCTGCAAACACTCCCTTGCAGG - Intronic
928912705 2:36439083-36439105 CAGGGGAAACATTCATTTGCAGG - Intronic
932410658 2:71545453-71545475 CTGGGGGAACAATCTGTTCCGGG + Intronic
932452928 2:71827337-71827359 CTGGGAAAGTAGTCTCTTGCTGG - Intergenic
933585279 2:84173479-84173501 CAGGGGATACACTTTTTTGCAGG - Intergenic
933842305 2:86297618-86297640 CCGGGGAGAATCTCTCTTGCAGG - Intronic
946773494 2:223113195-223113217 CTGGAGTAAGATTCTCTTGCTGG - Intronic
1170981454 20:21218050-21218072 ATTGGGAAGCACTGTCTTGCAGG - Intronic
1172034069 20:31999644-31999666 CTGGAGAAACAGTCTGTTTCTGG - Exonic
1175593475 20:60212349-60212371 CTGGGAAAGCATTCTCTGGCTGG - Intergenic
1175860723 20:62148764-62148786 CTGGCCATACACCCTCTTGCTGG + Intronic
1180087483 21:45514463-45514485 CTGGGGAGAGAATCTCTGGCTGG - Exonic
1184317028 22:43702501-43702523 CTGGGGAAACACTTTCTGTGTGG - Intronic
1184411308 22:44327946-44327968 CTGGGAAAAGCCTCTCTTGGGGG + Intergenic
949488606 3:4565605-4565627 GTGGGAACACACTCTCCTGCGGG - Intronic
954306382 3:49727716-49727738 CTGGGCAAACACTGTCTGGAAGG + Intronic
955487185 3:59447185-59447207 CTCAGGCAACACTATCTTGCTGG - Intergenic
957497239 3:81007845-81007867 CTGGGGGAACATTCTCTTCCAGG + Intergenic
965600454 3:170448872-170448894 ATGGGGAAAAACTCTCTAACAGG - Intronic
974195689 4:58571590-58571612 CTGAGGAGGCACTCTGTTGCTGG - Intergenic
977135348 4:93296746-93296768 CTCAGGAAACTATCTCTTGCTGG - Intronic
979451032 4:120871131-120871153 CTGAGGAAAAACTTTCTGGCAGG - Intronic
981349134 4:143708715-143708737 TTGGGGAAAGAATCTCTTCCAGG + Intergenic
982404662 4:155006341-155006363 CTGGGGAAACACAGTGTTGTAGG + Intergenic
984785530 4:183564248-183564270 CTGGGGAAAGACTCTTAGGCTGG + Intergenic
995225181 5:109692763-109692785 CTGTGGAAAAACTGTCTTCCAGG - Intronic
998186444 5:139983275-139983297 CTTGGGACTCACTCTCTTGGAGG - Intronic
999368440 5:151038193-151038215 CTGGGGAAACCCTTTCTTTTTGG - Intronic
1001940467 5:175736379-175736401 CTGGCAAATCATTCTCTTGCTGG + Intergenic
1002044745 5:176535680-176535702 CTGGGAGAGCACTCTCTTTCAGG + Intronic
1002062776 5:176636195-176636217 CTGGGTCACCACTCTCTAGCAGG + Intronic
1006093236 6:31640510-31640532 CTGGGGAAGCATTCTCCCGCTGG + Exonic
1011342216 6:86329040-86329062 CTGTGCAATCACTCTCTTCCTGG - Intergenic
1011733160 6:90286983-90287005 CTGGGAACACACTGTCTAGCGGG - Intronic
1014744993 6:125190475-125190497 CTGTGGAAAAACTGTCTTCCAGG - Intronic
1022455557 7:30555389-30555411 CTTGGGAAACACTCTCATGGTGG + Intergenic
1023694032 7:42826192-42826214 CTAGGAAAACACTGTCTTTCTGG + Intergenic
1024455628 7:49603898-49603920 CTGGTGAAAGACACTCTTGTAGG - Intergenic
1028583060 7:92426273-92426295 CTTGTGAAACATTCTCTTGGCGG - Intergenic
1036780095 8:11640952-11640974 CTGGGGAAACAGCCCCTTGAAGG - Intergenic
1037698004 8:21244295-21244317 CTGGGAAAATACCCTCTTGAAGG + Intergenic
1037904628 8:22708390-22708412 CTGGGGAAGGACTCTCTTCTGGG + Intergenic
1042978574 8:74500017-74500039 CTGGGGAAACAATCACTGGGTGG - Intergenic
1043141095 8:76591484-76591506 CTGAAGAAACACTATCTTGAAGG + Intergenic
1044513880 8:93116147-93116169 CTTTGGAAACACTCTATTTCGGG + Intergenic
1044518583 8:93169625-93169647 CTGTGGAAACACTTTCATTCTGG - Intergenic
1045475610 8:102549912-102549934 CTGGGGAAACAATATCATGAAGG + Intergenic
1047107617 8:121751219-121751241 CTGGGAAGACTCTCTCTTTCAGG + Intergenic
1048316526 8:133367158-133367180 CTGGGGGCACACTCTCATGGAGG - Intergenic
1049250955 8:141588761-141588783 AAGGGGCAACACTGTCTTGCAGG - Intergenic
1054081266 9:60617088-60617110 TTTTGGAAACACTCTTTTGCAGG - Intergenic
1056806179 9:89730785-89730807 CTGGGTAAACACACTCAAGCTGG - Intergenic
1058817058 9:108694197-108694219 CTGTGGAAACGCTATCATGCAGG + Intergenic
1061226118 9:129281913-129281935 CTGGGGAAACACTGACCTGAGGG - Intergenic
1187375456 X:18748920-18748942 ATGGGGAAACACACTCTTGACGG + Intronic