ID: 1135989963

View in Genome Browser
Species Human (GRCh38)
Location 16:27212345-27212367
Sequence CAACCCACACCCCATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135989963_1135989964 7 Left 1135989963 16:27212345-27212367 CCAAGGGCATGGGGTGTGGGTTG 0: 1
1: 0
2: 2
3: 28
4: 307
Right 1135989964 16:27212375-27212397 GTTTCATTTTTTTTACAGACAGG 0: 1
1: 1
2: 30
3: 777
4: 9779
1135989963_1135989965 8 Left 1135989963 16:27212345-27212367 CCAAGGGCATGGGGTGTGGGTTG 0: 1
1: 0
2: 2
3: 28
4: 307
Right 1135989965 16:27212376-27212398 TTTCATTTTTTTTACAGACAGGG 0: 1
1: 19
2: 479
3: 6821
4: 50807

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135989963 Original CRISPR CAACCCACACCCCATGCCCT TGG (reversed) Intronic
900373864 1:2344464-2344486 CACCCCACACCCCGTCCCCCAGG - Intronic
900421243 1:2556879-2556901 CAACCCAGACCCCCAGCACTGGG + Intronic
900512179 1:3066004-3066026 CAACCCACACTCACTGTCCTTGG + Intergenic
901181251 1:7343231-7343253 CCTCCCACACCCCAAGCCATCGG - Intronic
901508724 1:9703294-9703316 CAAGCCAATCCCCATGGCCTGGG + Intronic
901653372 1:10755632-10755654 CTCCCCACACCCCCTGCCTTCGG - Intronic
902337850 1:15764183-15764205 GAACCCAGAGCCCATGCTCTTGG - Intronic
902583241 1:17422626-17422648 CACCCCACGCCCCATCCCCAAGG + Intronic
903213663 1:21831740-21831762 CATCCCACACCACTGGCCCTGGG - Exonic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903349591 1:22710176-22710198 CCAGCCCCACCCCAGGCCCTCGG + Intergenic
903962698 1:27066775-27066797 CAAGCCCCATCCCATGCCCTGGG - Intergenic
904492887 1:30871334-30871356 CAACTCACACCACATCCCTTTGG + Intronic
904588070 1:31591003-31591025 CATCCCACACCCTTGGCCCTGGG - Intergenic
906474222 1:46157113-46157135 CAATCCAAACCTCAGGCCCTGGG - Intronic
911019937 1:93375847-93375869 CACCCCCCACCCCAAGTCCTGGG - Intergenic
911753476 1:101525649-101525671 CAACCCACCCCGCATACCTTAGG + Intergenic
912936148 1:114005161-114005183 CAAGCAACGCCCCCTGCCCTGGG - Intergenic
914666885 1:149840106-149840128 CCGCCCACACCCCGTGCCCCCGG + Exonic
914668882 1:149853684-149853706 CCGCCCACACCCCGTGCCCCCGG - Exonic
916018131 1:160768474-160768496 CAAGCCACACAGCAAGCCCTGGG + Intergenic
916356208 1:163911329-163911351 CCACCCTCACCCCCAGCCCTAGG - Intergenic
919140880 1:193570186-193570208 CATCCCACAGCCCATGACCCTGG - Intergenic
919739251 1:200972463-200972485 CACCCCACAGCCCAGGCCCCGGG - Intronic
922567538 1:226610792-226610814 CACCCCAGACCCTAGGCCCTGGG + Intergenic
922898843 1:229121046-229121068 AAACCCACACCCCCTTTCCTTGG + Intergenic
923850100 1:237784933-237784955 CAACCCAGTCCCCATGCCTGAGG + Exonic
924011494 1:239670252-239670274 CCACCCCCACCCCAAGCCCCAGG + Intronic
924568979 1:245220768-245220790 AAACCCACACCCCATCCTCTTGG - Intronic
1063376129 10:5555508-5555530 GCACCAACACCCCATGCCCGTGG + Intergenic
1063495786 10:6506352-6506374 CATCCTACACCCCATACCATTGG + Intronic
1065136857 10:22679857-22679879 CAACCCCTACCCCCAGCCCTAGG - Intronic
1065675494 10:28169126-28169148 CAACCCACACCTGATGGCATAGG - Intronic
1066200175 10:33136876-33136898 CAATCCACACCCCAAGCCCTTGG - Intergenic
1067047778 10:42995074-42995096 CATCCCCCACCCCTAGCCCTTGG - Intergenic
1067102492 10:43343096-43343118 CTACCCCCACCCCTTGTCCTGGG + Intergenic
1067160526 10:43821356-43821378 CAGACCACTCCCCATGCCCAGGG - Intergenic
1068653870 10:59554487-59554509 TAATACAGACCCCATGCCCTGGG + Intergenic
1069781721 10:70961247-70961269 CAATCCAATCCCCATGTCCTTGG + Intergenic
1070655345 10:78267410-78267432 CACCCCACACCCCTAGCCCAGGG + Intergenic
1071256863 10:83879003-83879025 CACCCCACATCCAATGCCCGGGG - Intergenic
1071514009 10:86285084-86285106 CAACCCACCCCCCATGGCCAGGG + Intronic
1072727192 10:97821966-97821988 CAACCCCCACCCTGTGCCCCAGG - Intergenic
1073321992 10:102621163-102621185 GAATCCCCAGCCCATGCCCTGGG + Intronic
1073422270 10:103434089-103434111 AAACCCACACACCAGGCACTGGG - Intronic
1075030875 10:119023903-119023925 CATCTCACACCCCCTGCCTTGGG - Intergenic
1075046632 10:119151409-119151431 CCACCCCCACCCCCAGCCCTAGG - Intronic
1076053829 10:127355481-127355503 CCACCAGCACCCCATGGCCTAGG - Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076547767 10:131257280-131257302 CAAAGGACACCCCATCCCCTGGG + Intronic
1076625872 10:131821635-131821657 CAACCCACATCATACGCCCTGGG + Intergenic
1077117049 11:889920-889942 GAACCCGCTCCCCATGGCCTTGG + Intronic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1077410991 11:2403805-2403827 CAGCCCACACCCCACACCCCAGG - Exonic
1077412003 11:2408011-2408033 CAACCAGCACCCCGTCCCCTGGG - Intronic
1077463367 11:2721982-2722004 CTACGCACACCCCCTGCCCCTGG + Intronic
1078792531 11:14558929-14558951 CAACCCAGAGCTCATGCCCTTGG - Intronic
1080688275 11:34534031-34534053 CAGGCCACTCCCCAAGCCCTAGG - Intergenic
1082693514 11:56332337-56332359 CAGGCCAAACCCCATGCCCCTGG - Intergenic
1083652587 11:64211798-64211820 GAGCCCATACCCCAGGCCCTAGG - Intronic
1084273723 11:68041579-68041601 CAGACCAGACCCCATGCCCCAGG - Intronic
1084359849 11:68662067-68662089 CTTCCCACACCTCATGTCCTGGG + Intergenic
1086053747 11:82624436-82624458 AAACCCACACAGCATGCCCCTGG - Intergenic
1089324566 11:117648261-117648283 CCACCCTCACCCCTTCCCCTGGG - Intronic
1089922619 11:122224433-122224455 GAAGCCACAACCCATGCCTTAGG - Intergenic
1091321952 11:134657898-134657920 CAACTCACCTCCCATGACCTGGG + Intergenic
1092154540 12:6273840-6273862 CACCCCACTCCCCATGCCCCAGG - Intergenic
1092215477 12:6678853-6678875 TATCCCACTCCCCATGTCCTTGG + Intronic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1092994269 12:13933554-13933576 CAACCCACTAGCCATTCCCTAGG + Intronic
1096258334 12:50076001-50076023 TAACGCACACACCATGCCCTGGG + Intronic
1096847762 12:54417473-54417495 CAACCCCCACCCCACCCCCCTGG - Intronic
1097624704 12:61985975-61985997 CAGCCCACAACCATTGCCCTTGG + Intronic
1101292670 12:103387532-103387554 CAACCCACTCCTCTTCCCCTTGG - Intronic
1102057945 12:109910802-109910824 CAGCCACCACCACATGCCCTCGG - Intronic
1102198667 12:111042410-111042432 CAGCTCACACCACATCCCCTGGG - Intronic
1102506560 12:113387920-113387942 CCACCCACAGCTCAGGCCCTAGG - Intronic
1102640961 12:114366201-114366223 CAACCCATACCCACTGCCCCAGG - Exonic
1103228292 12:119306679-119306701 CAAGCCTCACTCCATGCCCTGGG + Intergenic
1103340246 12:120217059-120217081 CCACGCACACCCCATGTCCCGGG - Intronic
1104367774 12:128193330-128193352 CCATCCACAGCCCCTGCCCTGGG + Intergenic
1104980314 12:132570565-132570587 CACCCCCCAACCCCTGCCCTGGG - Intronic
1105717340 13:23080701-23080723 CAAGGCACACCCCATCTCCTTGG + Intergenic
1109561626 13:64057152-64057174 CTACCCCCAACTCATGCCCTTGG - Intergenic
1109736472 13:66491345-66491367 CAACACACACACCATTTCCTTGG - Intronic
1113080776 13:106517581-106517603 CAAGCCACACGCCATGGCCTGGG - Intronic
1113804682 13:113106292-113106314 CACCCCATCCCCCATGCCCCAGG - Intronic
1114453092 14:22838950-22838972 CAACCTCCACCCCATACCCTCGG - Intronic
1114492705 14:23113427-23113449 AAACCCACACCCTCTCCCCTTGG + Intergenic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1119436268 14:74599819-74599841 CAACCCACTGCCCATGCTCAGGG - Intronic
1119743116 14:77026954-77026976 CCACCCCCTCCCCACGCCCTGGG - Exonic
1120054018 14:79900968-79900990 CTCCCCACTCCCCAAGCCCTTGG + Intergenic
1120970830 14:90205633-90205655 CCACCCACAGCCCAGCCCCTGGG + Intergenic
1121273339 14:92652010-92652032 CACGTCACACCCCATGCCCCAGG + Exonic
1121406023 14:93719873-93719895 CAGCCCACACCTGATGACCTGGG + Exonic
1122215419 14:100200464-100200486 AACCCCACTCCCCATCCCCTGGG + Intergenic
1122313369 14:100811421-100811443 CAACCCTCCCCCAATGCTCTTGG + Intergenic
1124690495 15:31817727-31817749 CCAGCCACCACCCATGCCCTTGG + Intronic
1124711088 15:32012492-32012514 CAACCTCCATCCCTTGCCCTTGG + Intergenic
1125600962 15:40915630-40915652 CAACCCCCGCCCCCTGCCCCTGG + Intergenic
1125731000 15:41892865-41892887 CATCCCAGACCCCTTTCCCTGGG + Intronic
1127783397 15:62335476-62335498 CCACCACCACCCCAGGCCCTTGG + Intergenic
1128315157 15:66655237-66655259 CCACCCACTCCCCAGGCCCCAGG - Intronic
1128450583 15:67803872-67803894 TAACCCAAACCCACTGCCCTGGG - Intronic
1128555687 15:68630224-68630246 CACCCCACACAGCATCCCCTGGG - Intronic
1130535627 15:84783290-84783312 CAAGCCAGAACCCCTGCCCTTGG + Exonic
1130650895 15:85761533-85761555 CCACCCCCACCCCAGGCTCTTGG + Intronic
1130938663 15:88490334-88490356 CCACCCCCACCCCCTGCCCTTGG + Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131852579 15:96558626-96558648 CAATCCACACATCCTGCCCTTGG - Intergenic
1132299341 15:100766708-100766730 CAACCTAGACCCCATTCCCTGGG + Intergenic
1132557782 16:579996-580018 CCACCCACACCCCACGGACTAGG - Intronic
1132587856 16:714111-714133 CCACCCACCACCCATGCCCTGGG + Intronic
1134556589 16:15170983-15171005 CAACCCTCTCAACATGCCCTGGG + Intergenic
1134847067 16:17449131-17449153 GAACCCACAGAGCATGCCCTGGG + Intronic
1135293468 16:21260106-21260128 CCACCCAGAGCCCATGCCATTGG - Intronic
1135424660 16:22326298-22326320 CCCCCCACCCCCCATGCCCCTGG - Intronic
1135989963 16:27212345-27212367 CAACCCACACCCCATGCCCTTGG - Intronic
1136315123 16:29449830-29449852 CATCCCACATCCCCTGCCATGGG - Intronic
1136429700 16:30189169-30189191 CATCCCACATCCCCTGCCATGGG - Intergenic
1136458293 16:30394958-30394980 CCACCCCCACCCCGGGCCCTCGG + Intronic
1138091106 16:54175356-54175378 GAACCCACGCACCTTGCCCTGGG - Intergenic
1138450991 16:57093225-57093247 CAACACCCACCCCCTGCCCCAGG + Intronic
1141033378 16:80608514-80608536 CAACCCACAACCCATGCCCATGG - Intronic
1141148300 16:81547287-81547309 CTGCACACACCCCATGCCCTCGG - Intronic
1141735664 16:85850750-85850772 CAACCCACAGACCATGAGCTAGG + Intergenic
1141815261 16:86405136-86405158 CCACGCACAGGCCATGCCCTGGG - Intergenic
1141919526 16:87126713-87126735 CAGCCCACTCCCAGTGCCCTTGG - Intronic
1142229641 16:88893848-88893870 ACACCCGCACCCCGTGCCCTTGG + Intronic
1143164307 17:4890200-4890222 CACCCCACACCCCGTCCCCCAGG + Intronic
1144077880 17:11735080-11735102 CATCCCACACCACGTGTCCTTGG - Intronic
1145005505 17:19335547-19335569 CACCCCCCACCCCACGCCCTCGG - Exonic
1145848703 17:28069073-28069095 CATCCCCCTCCCCCTGCCCTAGG + Intronic
1145890205 17:28408782-28408804 CAACCCTCTCCACATGCTCTGGG - Intergenic
1146446653 17:32937537-32937559 GAACCCACATCCCAGGCTCTGGG + Intronic
1146575331 17:33986030-33986052 TAACCCACACCTCTTGCCCCTGG + Intronic
1146618006 17:34372032-34372054 CACCCCACACCCCATCTCCTAGG + Intergenic
1146651711 17:34611208-34611230 CAACCCACACCCCCAGGTCTGGG - Intronic
1147162204 17:38574837-38574859 CACCCCACCCCCCAAGCCCATGG - Intronic
1148083220 17:44978842-44978864 CCAGGCACACCCCAAGCCCTTGG - Intergenic
1148455904 17:47811232-47811254 CAACCTCCACCCCACACCCTTGG + Intronic
1148824093 17:50379361-50379383 AAAGCCACACCCCAGCCCCTTGG - Intronic
1151187041 17:72372084-72372106 CTACCCACACCCCCAGCCCCAGG - Intergenic
1151360707 17:73587152-73587174 CAACTCAAATTCCATGCCCTTGG + Intronic
1151433430 17:74080158-74080180 CAACCCCCACCCAGGGCCCTGGG + Intergenic
1151536738 17:74743215-74743237 CAACCCCTACCCCAGCCCCTTGG + Intronic
1151551769 17:74826526-74826548 CAACTCACCCACCATGCACTTGG - Intronic
1151778331 17:76224822-76224844 CAACCCACGCCCCATGGGCTGGG - Intronic
1152362005 17:79837177-79837199 CAGCGCCCACCCCAGGCCCTTGG + Intronic
1152370209 17:79883110-79883132 CCACCCCCACCCCCAGCCCTAGG + Intergenic
1152377153 17:79924774-79924796 CCACCCAGAGCCCAAGCCCTCGG + Intergenic
1152747322 17:82047293-82047315 CAGCCAACAGCCCAGGCCCTTGG - Intergenic
1152891181 17:82882504-82882526 CATCCCCGAGCCCATGCCCTGGG + Intronic
1154514322 18:15145063-15145085 CATAACACACCCCATTCCCTGGG - Intergenic
1155128087 18:22900738-22900760 CTACCCATACAACATGCCCTTGG - Intronic
1155253117 18:23970195-23970217 CAACCCAGAGCCCATACCCCGGG + Intergenic
1157100019 18:44720906-44720928 CACCCCCCACCCCAACCCCTTGG + Intronic
1157476375 18:48026214-48026236 CAACCCACAGCCCAGACTCTTGG - Intergenic
1159945967 18:74445143-74445165 CAACCCCCACCCCCAGCTCTGGG - Intronic
1160158758 18:76455003-76455025 CAACCCCCGCCCCATCCCCTTGG + Intronic
1160272894 18:77403729-77403751 AAGGCCACACCCCAAGCCCTGGG + Intergenic
1160572421 18:79827259-79827281 CCACCCACATCTCCTGCCCTGGG - Intergenic
1161486191 19:4537105-4537127 TATCCCACACCCCAGGGCCTGGG + Exonic
1162901566 19:13798022-13798044 CAACCCACGCCCCACGGCCCTGG - Intronic
1163634743 19:18432761-18432783 CATCCCACAACCCCTGCCCAGGG - Intronic
1163697964 19:18773524-18773546 CACCCCACACCCCGAGCCCCAGG + Intronic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1165155602 19:33785383-33785405 AAACCAACACCCTATGTCCTAGG + Intergenic
1165806146 19:38582001-38582023 CAACCTCCTCCCTATGCCCTGGG + Intronic
1166299427 19:41905715-41905737 GACCCCACACCCCTGGCCCTGGG - Intronic
1167336297 19:48888097-48888119 CAATCCGCTCCCCCTGCCCTGGG - Exonic
1167441600 19:49512584-49512606 CAGGGCACACCCCAGGCCCTAGG - Exonic
1168312291 19:55466666-55466688 ACACACACACACCATGCCCTGGG - Intergenic
925082544 2:1081576-1081598 CCAGCCACACCCCATGCACCTGG + Intronic
925153458 2:1633315-1633337 CAACACACACCCTTGGCCCTCGG + Exonic
926140648 2:10365876-10365898 GAGCCCACACCGCATGTCCTCGG + Intronic
927277355 2:21273171-21273193 CAACCCTGACCTCATGACCTCGG - Intergenic
929139808 2:38656868-38656890 CAAGCCATACCCCACACCCTAGG + Intergenic
930106456 2:47644067-47644089 CTACCCTCATCCCATGCTCTTGG + Intergenic
931810179 2:65846976-65846998 CAACCCACAGCCACTGCCCATGG - Intergenic
932817531 2:74873979-74874001 CAGCCCACACCCCCATCCCTTGG - Intronic
938135724 2:128755051-128755073 CAACCCACATCCCTGACCCTCGG + Intergenic
942209217 2:173654061-173654083 CACCTCACTCCCCATGCCATGGG + Intergenic
942319219 2:174721735-174721757 CAACTCACAACCCCTGGCCTTGG - Intergenic
946382455 2:219358412-219358434 CACCCCACACCCGATGGCCACGG - Intergenic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
947810006 2:232998216-232998238 CTACTCCCACCCCATCCCCTGGG - Intronic
948338629 2:237231299-237231321 CAACCCCCACTCCATACCCCTGG + Intergenic
948601691 2:239111234-239111256 CAGTCCACAGCCCATGCCCGTGG - Intronic
948679303 2:239621815-239621837 CCACCCACACCCCCAGCCCCAGG - Intergenic
1171102699 20:22400424-22400446 CCACCCCCACCCCAAGCCCCTGG + Intergenic
1171198553 20:23223045-23223067 CATCAGACACCCCATCCCCTGGG + Intergenic
1171302141 20:24072604-24072626 TAACCCAACCCCCAAGCCCTGGG + Intergenic
1171329598 20:24325901-24325923 CAACCCACAACCAATGGCCAAGG - Intergenic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172424250 20:34844783-34844805 CCACCCCTACCCCATACCCTGGG + Exonic
1172573809 20:35991374-35991396 CAACACACACACCACGCCCCTGG - Intronic
1173460057 20:43235985-43236007 AAGCCCACACCCCGTGTCCTGGG - Intergenic
1173464710 20:43271711-43271733 CACCCCACATCCCATGCCACGGG - Intergenic
1174423128 20:50413451-50413473 CCACCCACACCCCAGCCCTTTGG - Intergenic
1175469353 20:59216126-59216148 CAACCCCCACACCCTTCCCTGGG + Intronic
1175727486 20:61329445-61329467 CAACCCACATCCCAGACCCACGG - Intronic
1175737644 20:61398460-61398482 CTTGCCAGACCCCATGCCCTTGG - Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1176297022 21:5079215-5079237 CGCCCCACACCCCATGCCCCAGG + Intergenic
1177624398 21:23641411-23641433 CCACCAAACCCCCATGCCCTAGG - Intergenic
1178374470 21:32055438-32055460 CATCCAACACCCCAAGCCCTTGG - Intergenic
1178919386 21:36728698-36728720 CAGCCCAGGCCCCATCCCCTTGG - Intronic
1179860006 21:44182732-44182754 CGCCCCACACCCCATGCCCCAGG - Intergenic
1181510640 22:23387243-23387265 CAGGCCACAGCCCAGGCCCTGGG + Intergenic
1182115781 22:27755504-27755526 CACCTCACACTCCATGCCCAGGG + Intronic
1182366386 22:29782186-29782208 CACCCCACACCCCACTCTCTTGG - Intergenic
1182533143 22:30977807-30977829 CAACCCACACCTCACCCACTAGG + Intergenic
1182685995 22:32122161-32122183 CAACCCACCCCCCATGCCTCAGG - Intergenic
1183055955 22:35305720-35305742 GTAACCACACACCATGCCCTTGG - Intronic
1183482770 22:38074292-38074314 CCACCCCCGCCCCAGGCCCTAGG + Exonic
1183491152 22:38116275-38116297 CAATTCACACCCCAGGGCCTTGG + Intronic
1183672328 22:39280318-39280340 CAACCCAGGCCCCAGGCCCCAGG + Intergenic
1184644444 22:45888659-45888681 GAGCCCACGCCCCCTGCCCTCGG + Intergenic
1184650917 22:45919114-45919136 CAACCCCCACCCAGTCCCCTCGG - Intergenic
1185205231 22:49534053-49534075 ACACCCAGACCCCATGGCCTGGG + Intronic
950217304 3:11168734-11168756 CAGCCCGCACCCCCAGCCCTGGG - Intronic
954624700 3:52016161-52016183 CATCCGCCACCCCATCCCCTGGG + Intergenic
954688998 3:52385968-52385990 CAAGCCACACGCCAGGCCCATGG + Intronic
955144879 3:56307122-56307144 TATCCTACACCCCCTGCCCTTGG - Intronic
959129189 3:102331696-102331718 CACCCCACACCCCACCCCTTTGG + Intronic
961007685 3:123415735-123415757 TAACCCAAACACCATGCCCTTGG + Intronic
964992329 3:162829020-162829042 CCACCACCACCCCATGCCCATGG - Intergenic
968401821 4:304874-304896 CAAACCACAAGCCATGCCCGGGG + Intronic
968608705 4:1547244-1547266 GGACCCACACCCCCTGCCCAAGG + Intergenic
968921049 4:3522530-3522552 CATCCCACACGCCCTGCCCGGGG + Intronic
968926523 4:3551369-3551391 CCACCCACACCCCAAGCCTGGGG + Intergenic
969045553 4:4334051-4334073 TCACCCACAACCCATGCCCCTGG + Intergenic
970479541 4:16459102-16459124 GAGCCCATACCCCATGGCCTGGG - Intergenic
972319121 4:37956401-37956423 CAAACCAAAACCCCTGCCCTCGG - Intronic
972462566 4:39318323-39318345 CTGCCCACACCACATTCCCTGGG + Intronic
981654673 4:147099891-147099913 CATCCCCCACCACATTCCCTTGG - Intergenic
981782546 4:148444414-148444436 CAACCCGCGCCCTCTGCCCTGGG + Intronic
984149754 4:176112241-176112263 CCACTCACATCCCGTGCCCTTGG + Intronic
984196439 4:176663281-176663303 CAAACCACACCCCTCACCCTAGG + Intergenic
986818716 5:11441631-11441653 CACCCCCCACCCCACCCCCTTGG + Intronic
993828971 5:92729511-92729533 CCACCCCCACCCCATGGCCTTGG + Intergenic
997431621 5:133844898-133844920 CAACCCCCACGCCATAGCCTTGG + Intergenic
1000328109 5:160187508-160187530 CAACCCCCACCCCGTGCTGTTGG - Intronic
1000364116 5:160475173-160475195 CAACCCATACACCTTGTCCTGGG - Intergenic
1001582216 5:172806509-172806531 CACTCCACACCCCATGCTCTGGG - Intergenic
1004587422 6:17015940-17015962 CAACCCACCCGCCATGCCCGAGG - Intergenic
1004922610 6:20390697-20390719 CAACCCGCAGCCCATGGCCCAGG - Intergenic
1005816345 6:29555854-29555876 CTGCCAACACCCCATGCCCAGGG + Exonic
1006223270 6:32513911-32513933 CCACCAATACCCCAAGCCCTAGG + Intergenic
1006287091 6:33104828-33104850 CATCCCACACCTCCTGCTCTTGG - Intergenic
1007450464 6:41937968-41937990 CAACCCAAGCCACATCCCCTTGG + Intronic
1007782505 6:44262697-44262719 CAACCCACTCCCTCTGGCCTGGG - Intronic
1008159713 6:48062346-48062368 CCACCCCCACCCCAAGTCCTTGG + Intronic
1008710566 6:54221216-54221238 CAACTCATACCCCAAACCCTGGG + Intronic
1010556810 6:77292209-77292231 CAAACCACAGCCTTTGCCCTTGG + Intergenic
1013196752 6:107850882-107850904 CCACCCCCACCCCACCCCCTTGG + Intergenic
1017526995 6:155249997-155250019 GACCCCACACCACATGCACTAGG - Intronic
1019597187 7:1863617-1863639 CTGCCCACACCCCACGCGCTGGG + Intronic
1021175013 7:17440234-17440256 CCACCCCCACCCCCTGCCCGTGG + Intergenic
1022355281 7:29608970-29608992 TTACCCACACCCCATCCACTTGG - Intergenic
1023410424 7:39884522-39884544 CACCCCACTCCCTGTGCCCTGGG + Intergenic
1026019569 7:66697025-66697047 CACCCCTGACCCCATGCCCCAGG + Intronic
1026994383 7:74606225-74606247 CCACCCTCAGCCCCTGCCCTGGG + Intergenic
1027233850 7:76286574-76286596 CTCTCCTCACCCCATGCCCTGGG + Exonic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1031575584 7:123412105-123412127 CAACCCCCATCCCAAGCCTTGGG + Intergenic
1032580466 7:133098888-133098910 CTACCCTCACCCCATCCCCATGG + Intergenic
1033500460 7:141943857-141943879 CAACCTACTCCCCATCCCCTAGG - Intronic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1035626211 8:1072585-1072607 GAACACACACCCAATGCTCTCGG - Intergenic
1037530355 8:19766831-19766853 CATCCCCCACCCCCTGCCCGTGG + Intergenic
1037701714 8:21281340-21281362 GGACCCACACCCCTTGCCGTAGG + Intergenic
1037929848 8:22872353-22872375 CAAGCCACACCTCCTGGCCTAGG + Intronic
1038805883 8:30790788-30790810 GAACCCACAGCCCCAGCCCTGGG + Intronic
1039493420 8:37964526-37964548 CCACCCGCCCCCCAAGCCCTCGG - Intronic
1039525083 8:38207546-38207568 CAACATACCCCCCAGGCCCTGGG + Exonic
1042536056 8:69860214-69860236 CAACATACCCCCCAGGCCCTGGG - Intergenic
1045657982 8:104406529-104406551 CCACCCACACCACATACCCAGGG + Intronic
1046093464 8:109530816-109530838 CAACCCTCAACTCATGCCCGGGG - Intergenic
1046465804 8:114601730-114601752 CAACCCAAATCCCATTCCATGGG + Intergenic
1048269516 8:133017430-133017452 CAAACAACACCCAATCCCCTGGG - Intronic
1049009689 8:139879206-139879228 CGCCCCACCCCCCATGACCTGGG - Intronic
1049226218 8:141451755-141451777 ACACCCACATCCCATCCCCTAGG - Intergenic
1049341250 8:142113781-142113803 CCACCTACACCCCATCACCTGGG + Intergenic
1049397254 8:142406755-142406777 TCCCACACACCCCATGCCCTTGG - Intergenic
1049404117 8:142444069-142444091 CAAGCCACACTTCATGCCCTTGG + Intergenic
1051235688 9:14996250-14996272 CAACCCACGACCCCTGCCCGGGG - Intergenic
1053169377 9:35867941-35867963 CCATCCTCACCTCATGCCCTGGG - Intergenic
1053801445 9:41766751-41766773 CCACCCACACCCCAAGCCTGGGG + Intergenic
1054143755 9:61548075-61548097 CCACCCACACCCCAAGCCTGGGG - Intergenic
1054189876 9:61978905-61978927 CCACCCACACCCCAAGCCTGGGG + Intergenic
1054463529 9:65479410-65479432 CCACCCACACCCCAAGCCTGGGG - Intergenic
1054648636 9:67609686-67609708 CCACCCACACCCCAAGCCTGGGG - Intergenic
1054892808 9:70270450-70270472 CAACCTACTCCCCATCCTCTGGG - Intronic
1057182557 9:93037891-93037913 CATCCCACAGCCCAGGGCCTGGG + Intergenic
1059401828 9:114075622-114075644 CAAGACAGACCCCATTCCCTGGG + Intronic
1060353397 9:122879887-122879909 CCCCCCAACCCCCATGCCCTTGG - Intronic
1060427962 9:123522196-123522218 CAACACAGACCCCATGTCCAAGG - Intronic
1060703367 9:125779076-125779098 CATCCCCCACCCCTAGCCCTTGG + Intronic
1061485460 9:130918361-130918383 CCACCCACCCCCCATTCCTTGGG - Intronic
1061639957 9:131945589-131945611 CAACCCCCATGCCAAGCCCTTGG + Intronic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062581712 9:137231828-137231850 CCACCCACCCCCCAGGCACTGGG + Intronic
1187283664 X:17882505-17882527 CTACCCCCACCCCACTCCCTGGG - Intergenic
1187366226 X:18667590-18667612 CCACCAACACCCCTTGCCTTTGG - Intronic
1187374671 X:18741123-18741145 CCACCCACTCCCCATTCCTTAGG - Intronic
1187674950 X:21707099-21707121 CACCCCCCACCCCAAGCCCCTGG + Intronic
1189128318 X:38471848-38471870 CTACCCTCACCCCACCCCCTTGG - Intronic
1189640823 X:43068477-43068499 CTACCACCACCCCATGCCCATGG - Intergenic
1190172306 X:48121430-48121452 CACCCCAGCCCCCAGGCCCTTGG - Intergenic
1190177948 X:48167079-48167101 CACCCCAGCCCCCAGGCCCTTGG - Intergenic
1190180198 X:48185344-48185366 CACCCCAGCCCCCAGGCCCTTGG + Intergenic
1190183919 X:48218725-48218747 CACCCCAGCCCCCAGGCCCTTGG - Intronic
1190189846 X:48268177-48268199 CACCCCAGCCCCCAGGCCCTTGG - Intronic
1190193214 X:48294567-48294589 CACCCCAGCCCCCAGGCCCTTGG + Intergenic
1190197071 X:48328866-48328888 CACCCCAGCCCCCAGGCCCTTGG - Intergenic
1190204779 X:48394200-48394222 CACCCCAGCCCCCAGGCCCTTGG - Intergenic
1190205757 X:48401203-48401225 CACCCCAGCCCCCAGGCCCTTGG + Intergenic
1190210619 X:48443828-48443850 CACCCCAGCCCCCAGGCCCTTGG - Intergenic
1190289592 X:48983497-48983519 CAACCCTCTTCCCATGCCCAAGG + Intronic
1190663805 X:52679245-52679267 CACCCCAGCCCCCAGGCCCTTGG - Intronic
1190675618 X:52779177-52779199 CACCCCAGCCCCCAGGCCCTTGG + Intronic
1192261662 X:69509263-69509285 CAACCCCCACCCCACTCTCTTGG + Intronic
1194002362 X:88446270-88446292 CATCCCCCACCCCAAGCCCCTGG - Intergenic
1194143919 X:90240804-90240826 CCACCCAGATCCCATGCACTTGG - Intergenic
1197642024 X:128977493-128977515 CAAGCCACATTCTATGCCCTGGG - Intergenic
1197803442 X:130376114-130376136 CAACCCACATCCTTTCCCCTAGG + Intergenic
1198942520 X:141972477-141972499 CAACTCACACACCCTTCCCTTGG - Intergenic
1198995177 X:142566507-142566529 CTACCACCACCACATGCCCTTGG + Intergenic
1199855996 X:151759206-151759228 CCCACCACACCACATGCCCTGGG - Intergenic
1200489679 Y:3810105-3810127 CCACCCAGATCCCATGCACTTGG - Intergenic
1201773782 Y:17643337-17643359 CATCCCACACCCCAGGCTTTGGG - Intergenic
1201827775 Y:18262652-18262674 CATCCCACACCCCAGGCTTTGGG + Intergenic