ID: 1135990627

View in Genome Browser
Species Human (GRCh38)
Location 16:27216617-27216639
Sequence CTGTATCTACTGCTGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 121, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135990625_1135990627 -2 Left 1135990625 16:27216596-27216618 CCCTGGGATGCTGATCAGCTGCT 0: 1
1: 0
2: 3
3: 11
4: 180
Right 1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG 0: 1
1: 0
2: 4
3: 121
4: 256
1135990626_1135990627 -3 Left 1135990626 16:27216597-27216619 CCTGGGATGCTGATCAGCTGCTG 0: 1
1: 0
2: 2
3: 28
4: 209
Right 1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG 0: 1
1: 0
2: 4
3: 121
4: 256
1135990620_1135990627 21 Left 1135990620 16:27216573-27216595 CCTCTGTAGCCTTTGCAGTGGGG 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG 0: 1
1: 0
2: 4
3: 121
4: 256
1135990624_1135990627 12 Left 1135990624 16:27216582-27216604 CCTTTGCAGTGGGGCCCTGGGAT 0: 1
1: 0
2: 2
3: 19
4: 178
Right 1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG 0: 1
1: 0
2: 4
3: 121
4: 256
1135990617_1135990627 26 Left 1135990617 16:27216568-27216590 CCGCACCTCTGTAGCCTTTGCAG 0: 1
1: 0
2: 4
3: 20
4: 245
Right 1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG 0: 1
1: 0
2: 4
3: 121
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135990627 Original CRISPR CTGTATCTACTGCTGAAGCC AGG Intronic
900206287 1:1433263-1433285 CTTCATCTTCTGCAGAAGCCTGG + Intergenic
901904451 1:12395564-12395586 CAGTATCTGCTTCTGAAGCTGGG + Intronic
903267766 1:22168379-22168401 CTGTCTCCACTTCTGATGCCAGG + Intergenic
905464827 1:38145212-38145234 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
906930928 1:50168514-50168536 CAGTATCTGCTTCTGAAGCTGGG + Intronic
907779959 1:57557886-57557908 CAGTATCTGCTTCTGAAGCCGGG - Intronic
908087758 1:60654395-60654417 CTGGATCTACTGCTGAAGCTAGG - Intergenic
908616634 1:65929598-65929620 CAGTATTTGCTTCTGAAGCCAGG + Intronic
908737186 1:67289207-67289229 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
909549337 1:76880038-76880060 CAGTATCTGCTTCTGAAGCCAGG + Intronic
909810634 1:79928683-79928705 CAATATCTACTTCTGAAGCTGGG - Intergenic
909839544 1:80301850-80301872 CTGTACCTACTGCTTAGGCTGGG + Intergenic
910587790 1:88898544-88898566 CAATATCTGCTTCTGAAGCCAGG - Intergenic
910639346 1:89442852-89442874 CAGTATCTGCTTCTGAATCCAGG + Intergenic
911982308 1:104582513-104582535 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
912733703 1:112131709-112131731 CAGTATTTGCTTCTGAAGCCAGG + Intergenic
915359696 1:155278389-155278411 CTGTCCCTAGTGCTGAAGGCGGG + Intronic
915838560 1:159197645-159197667 CTGTCACTACTCCTGAAGCTGGG - Intronic
915838638 1:159198146-159198168 CTGTTTCCAGTGCTGACGCCTGG + Intronic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
917462352 1:175243327-175243349 CAGTATCTGCTTCTGAAGCTTGG - Intergenic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
918756141 1:188340982-188341004 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
918957892 1:191235144-191235166 CGGTATCTTCTTCTGCAGCCAGG - Intergenic
919230387 1:194765441-194765463 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
919241425 1:194921620-194921642 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
920197036 1:204235445-204235467 CAGTATCTGCTTCTGAAGCTGGG - Intronic
1062770872 10:99566-99588 CAGTATCTACTTCTGAAGTTGGG + Intergenic
1064517933 10:16170401-16170423 CTGTATTTAATGCTGCAGCTCGG - Intergenic
1064518039 10:16171124-16171146 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1066409566 10:35153652-35153674 CCATAGCTGCTGCTGAAGCCTGG + Intronic
1067125968 10:43515737-43515759 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1067332760 10:45337326-45337348 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1067754788 10:48996919-48996941 CAGTATCTGCTTCTAAAGCCAGG + Intergenic
1067982837 10:51106588-51106610 CTGTCTCTGCTGCTGAAGAAAGG - Intronic
1068225722 10:54104514-54104536 CAGTATCTGCTTCTGAAGCCAGG + Intronic
1068836440 10:61559610-61559632 CTATATTTACTGCTGCTGCCTGG - Intergenic
1069192693 10:65509241-65509263 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1069791257 10:71022624-71022646 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1071100436 10:82030466-82030488 GTGTAACTACTGCATAAGCCAGG - Intronic
1071937325 10:90546438-90546460 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1071943168 10:90610665-90610687 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1072360105 10:94651298-94651320 CAGTATCCACTTCTGAAGCTGGG - Intergenic
1073210613 10:101798806-101798828 ATGTACCTGCTGCTGAAGCCTGG - Intronic
1073854714 10:107661290-107661312 CAGTATCTGCTTCTGAAGCCGGG - Intergenic
1076292081 10:129353338-129353360 GTGTATCTCGTGCTGGAGCCTGG - Intergenic
1076927793 10:133502122-133502144 CAGTATCTGCCTCTGAAGCCAGG + Intergenic
1077564114 11:3285557-3285579 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1077570004 11:3331374-3331396 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1079972625 11:27055404-27055426 CAGCATCTACTCCTGAAGACCGG + Exonic
1080855294 11:36106689-36106711 CTTTAGCTACTGCTGAAACTTGG + Intronic
1081072414 11:38628195-38628217 CAGTATCTGCTTCTGAAGGCAGG - Intergenic
1081608650 11:44544945-44544967 CAGTGTCTGCTTCTGAAGCCAGG - Intergenic
1081973791 11:47217979-47218001 CTGTTTCTATTCCTGAAACCGGG + Intronic
1084506985 11:69574582-69574604 CTGTACCTGTTGCTGAGGCCTGG + Intergenic
1084732096 11:71080250-71080272 CTGAATCTCCTGCTGAGGCCTGG + Intronic
1084843237 11:71876106-71876128 CTGTCAGTACTGCTGAAGGCAGG + Intronic
1084883762 11:72190146-72190168 CTGTGGCTGCTTCTGAAGCCAGG - Intronic
1085351626 11:75801559-75801581 CTGCATCTGCTGCTGACACCTGG + Intergenic
1085685566 11:78619291-78619313 CAGTTTCTGCTGCTGAAGCCAGG - Intergenic
1085747188 11:79125337-79125359 CACTATCTGCTTCTGAAGCCAGG - Intronic
1086961940 11:92986748-92986770 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1087289491 11:96304196-96304218 CTGATTCTACTGCTGAGGCCTGG + Intronic
1088407989 11:109501565-109501587 CAGTATCTGCTTCTGAAGCTAGG + Intergenic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1089283747 11:117392503-117392525 CTGTATCTTCTTCTGGAGGCTGG - Exonic
1090210042 11:124912674-124912696 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1090221989 11:125034496-125034518 CAGTGTCTGCTTCTGAAGCCAGG + Intronic
1091051355 11:132375843-132375865 CAGTATCTGCTTCTGAAGGCAGG - Intergenic
1093035870 12:14332134-14332156 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1094102156 12:26776363-26776385 CCGTAGCTGCTTCTGAAGCCAGG - Intronic
1094455772 12:30631215-30631237 CTGTCTCTACTGCTGAAAGGGGG + Intronic
1095603696 12:44043198-44043220 TAGTATCTGCTTCTGAAGCCAGG - Intronic
1095856605 12:46866558-46866580 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1095945284 12:47750121-47750143 CTTTGTCTCCTGCTGAATCCTGG - Intronic
1097431887 12:59519124-59519146 CAGTATCTGCTACTGAAGCCGGG + Intergenic
1097770616 12:63580266-63580288 AAGTATCTTCTGCTGTAGCCTGG + Intronic
1097821824 12:64135412-64135434 CAGTATCTGCTTCTGAAGCCAGG + Intronic
1098749457 12:74276587-74276609 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1098805072 12:75013168-75013190 CAGTATCCACTTCTGAAGCCAGG - Intergenic
1099350639 12:81564801-81564823 CAGTATCTGCTTTTGAAGCCGGG - Intronic
1100082946 12:90875334-90875356 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1100241558 12:92714598-92714620 CAGTGTCTGCTTCTGAAGCCAGG + Intergenic
1100672990 12:96836203-96836225 GTTTATCTACTGTTGAAGTCAGG + Intronic
1101154942 12:101918447-101918469 CTGTATCTCCTACTGTAGGCTGG + Intronic
1101263741 12:103063205-103063227 CTGTATCTGCTTCTGAAGCCGGG - Intergenic
1104868332 12:131975114-131975136 CTGTGTCTTCTGCAGAACCCAGG + Intronic
1107014354 13:35696532-35696554 CTGAGCCTTCTGCTGAAGCCTGG + Intergenic
1107424799 13:40282102-40282124 CAATATCTATTTCTGAAGCCAGG + Intergenic
1107983961 13:45758872-45758894 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1108030615 13:46225384-46225406 CTGCTACTGCTGCTGAAGCCTGG - Intronic
1108903869 13:55446772-55446794 CAGTATCTGTTTCTGAAGCCGGG - Intergenic
1109292767 13:60496745-60496767 CAGTATCTGCTTCTGAAGCCAGG - Intronic
1109582676 13:64363228-64363250 CAGTATCTGCTCCTGAAGCTGGG - Intergenic
1111016563 13:82388734-82388756 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1113094197 13:106646455-106646477 CTGCATCTGCTGCTGAGGCCAGG - Intergenic
1113320090 13:109224584-109224606 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1113785884 13:113001956-113001978 CTGTGGCTGCTGCTGAAGGCCGG + Intronic
1116058534 14:39894035-39894057 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1119060133 14:71465346-71465368 CAGTATGTGCTTCTGAAGCCAGG + Intronic
1119107872 14:71941059-71941081 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1120556383 14:85933332-85933354 CAGTATCTGCTTCTGAGGCCGGG + Intergenic
1128919176 15:71594638-71594660 CCATGTCTGCTGCTGAAGCCTGG - Intronic
1129961785 15:79692963-79692985 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1132971269 16:2690351-2690373 CTGTGGCTCCGGCTGAAGCCTGG + Intronic
1135216346 16:20574841-20574863 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1135867478 16:26117567-26117589 CTGTGTCTGCTGCTCCAGCCAGG + Intronic
1135990627 16:27216617-27216639 CTGTATCTACTGCTGAAGCCAGG + Intronic
1138868019 16:60847871-60847893 CTGTATCTGCTTCTGAAGCTGGG - Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1140267865 16:73435833-73435855 GGGTATCTGCTGCTGAAGCCTGG + Intergenic
1140597800 16:76436543-76436565 CACTATCTGCTTCTGAAGCCAGG + Intronic
1141377882 16:83548480-83548502 ATGTTTCTACATCTGAAGCCAGG - Intronic
1142704346 17:1684874-1684896 CTGGATCAACTGCTGAACTCGGG - Intronic
1142772134 17:2106128-2106150 CAGTATCTCCTCCTTAAGCCTGG - Intronic
1143084296 17:4404227-4404249 CTGTGTCCACTCCTGAAGCTGGG + Intergenic
1145387302 17:22424531-22424553 CTGTATGTTGTGCTGAAACCAGG + Intergenic
1146237813 17:31184716-31184738 CAGTATCTGCTTCTGAAGACAGG - Intronic
1146758442 17:35454257-35454279 CAGTATCTGCTTCTGAAGCCGGG - Intergenic
1146836104 17:36112202-36112224 TAGTATCTATTTCTGAAGCCGGG - Intergenic
1146850538 17:36218050-36218072 CAGTATCTGCTTCTGAAGCCAGG - Intronic
1147438656 17:40433387-40433409 CTGTCTCCTCTCCTGAAGCCTGG - Intergenic
1149236390 17:54595152-54595174 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1149255007 17:54816370-54816392 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1150132881 17:62678774-62678796 CTGCATCTGCTGCTGGTGCCAGG + Intronic
1150991791 17:70268285-70268307 CTGTATCATCTGCCGATGCCTGG - Intergenic
1151038003 17:70823120-70823142 CAGTATCTGCTTCTGAAGCTAGG + Intergenic
1151323201 17:73363868-73363890 CTGGATCTCCTGCTGGGGCCTGG + Intronic
1151678543 17:75612342-75612364 TTGTATTTACTGCTGAAGTCTGG - Intergenic
1153218098 18:2838512-2838534 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1154068089 18:11128229-11128251 CAGTATGTGCTTCTGAAGCCTGG - Intronic
1154148284 18:11884811-11884833 TTGTCTCTCCTGCTGGAGCCTGG - Exonic
1155573464 18:27220302-27220324 CAGTATCTGCTCCTGAAGCTGGG - Intergenic
1155628070 18:27859618-27859640 ATGTTTCTACTTCTGCAGCCAGG - Intergenic
1156303491 18:35855858-35855880 CAGTATCTTCGTCTGAAGCCAGG - Intergenic
1156537402 18:37877616-37877638 CAATATCTGCTTCTGAAGCCAGG - Intergenic
1156812077 18:41264751-41264773 CTGTAGCTGCTGCTGAAGCAGGG + Intergenic
1156998228 18:43494811-43494833 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1157485781 18:48085844-48085866 CTGAATCTGCTGCTGGAGCCAGG - Intronic
1159264860 18:66067729-66067751 CTGTTTCTTCTACTGAAGCTTGG - Intergenic
1159559469 18:69978023-69978045 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1159597062 18:70392680-70392702 CTGTAGCTTCTGGTGAATCCTGG + Intergenic
1168539724 19:57200046-57200068 TAGTATCTGCTTCTGAAGCCAGG - Intronic
925460344 2:4057570-4057592 CAGTATCTGCTTCTGAAGGCAGG - Intergenic
925499780 2:4489820-4489842 CAATATCTGCTTCTGAAGCCAGG + Intergenic
926559043 2:14395016-14395038 CTGGGTCTCCTGCTGAAGCTAGG + Intergenic
926674610 2:15610796-15610818 CTGTATCTATTGCTGAAGTGCGG - Intronic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
926810783 2:16753586-16753608 CAGTATTTGCTTCTGAAGCCGGG + Intergenic
927856721 2:26532361-26532383 CTGAATCCTCTCCTGAAGCCTGG + Intronic
930536973 2:52655171-52655193 CAGTATCTGCTTCTGAAACCAGG + Intergenic
935145691 2:100393639-100393661 CTGTATTTTCTGATGATGCCAGG + Exonic
935183671 2:100712912-100712934 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
935425478 2:102914235-102914257 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
937572086 2:123376265-123376287 CTGTGTCTGCTGCAGAAACCAGG + Intergenic
937785575 2:125890571-125890593 AAGTATCTGCTTCTGAAGCCTGG + Intergenic
937852938 2:126651600-126651622 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
939068704 2:137514949-137514971 CAGTATTTGCTTCTGAAGCCGGG - Intronic
939789055 2:146548982-146549004 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
940171705 2:150835629-150835651 CAGTATCTGCTTCTGAATCCAGG + Intergenic
940606296 2:155927266-155927288 TAGTATCTACTTTTGAAGCCAGG + Intergenic
941667569 2:168257913-168257935 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
943239631 2:185365819-185365841 CAGTATCTACTTCTGAAGCCGGG + Intergenic
943318225 2:186414571-186414593 CAGGATCTGCTTCTGAAGCCAGG + Intergenic
943384398 2:187183765-187183787 CAGTATCTGCTTCGGAAGCCAGG + Intergenic
943392273 2:187284688-187284710 CGGTATCTGCTTCTGAAGCCAGG + Intergenic
943509100 2:188802381-188802403 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
943916725 2:193644308-193644330 CTGTTTCTACATCTGAAGTCAGG + Intergenic
944129507 2:196331813-196331835 CTGTATCTAGTGGTAATGCCTGG - Intronic
946391691 2:219420091-219420113 CTGAATCTCCTCCTGCAGCCTGG - Exonic
946949146 2:224853621-224853643 CCGTATCTACTGATGAAGAGAGG - Intronic
948042858 2:234917601-234917623 ATGAATCTACAGCTGTAGCCAGG + Intergenic
948740591 2:240043486-240043508 CTGCATCCACTGCTCAACCCAGG + Intergenic
1171296310 20:24020186-24020208 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173003397 20:39121760-39121782 CTGTACCCACTGCTCAGGCCAGG - Intergenic
1173709518 20:45142138-45142160 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1174398777 20:50264640-50264662 CTGGATCTTCAGCTGGAGCCAGG - Intergenic
1177003013 21:15636450-15636472 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1177363344 21:20102942-20102964 CAGTATCTGCTTCTGAAGCCCGG - Intergenic
1178061123 21:28854059-28854081 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1178061755 21:28860588-28860610 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1178194248 21:30324908-30324930 ATGTATCCACTGTTGAAACCGGG + Intergenic
1178821668 21:35981145-35981167 CTGTTGCTACTGCAGAAGCCCGG - Intronic
1182350606 22:29697264-29697286 CCGTGTCTACTTCTGAAGTCTGG + Exonic
1184603954 22:45561304-45561326 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1185000375 22:48241853-48241875 CTGAATCTCCTGCTGTGGCCTGG + Intergenic
949126042 3:446051-446073 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
949418039 3:3834096-3834118 CGGTATCTGCTTCTGAAGCCAGG + Intronic
949445234 3:4128103-4128125 CAGTATCTGCTTCTGAAGCCAGG - Intronic
951122211 3:18942676-18942698 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
951291004 3:20872488-20872510 CATCATCTACTTCTGAAGCCAGG - Intergenic
951384158 3:22024854-22024876 CAGTATCTGCTTCTGAAGCTGGG - Intronic
951971124 3:28444722-28444744 CAGTATCTGCTTCTGAAGCCAGG + Intronic
954053686 3:48004501-48004523 CAGTATCTGCTTCTGAAGCCAGG - Intronic
955817279 3:62858501-62858523 CTGTATCTACTTCTAAAGCTGGG + Intronic
956509261 3:69977450-69977472 CAGTATCTGCTACTGAAGCCAGG - Intergenic
957247914 3:77736243-77736265 CAGTATCTGCTTCTGAAGCCTGG + Intergenic
957754230 3:84466459-84466481 CAGTATCTGCTTCTGTAGCCAGG - Intergenic
957897744 3:86445839-86445861 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
958499462 3:94887201-94887223 CAGTATCTGCTTCTGAAACCAGG - Intergenic
958933894 3:100237407-100237429 CAGAATCTGCTTCTGAAGCCGGG - Intergenic
960349177 3:116573077-116573099 CGGTATCTGCTTCTGAAGCCAGG - Intronic
960928600 3:122821305-122821327 CTCTGTCTACTTCTGAAGCCTGG - Intronic
961141457 3:124559907-124559929 CTGTATCTAAAGCTTGAGCCCGG + Intronic
962685301 3:137842035-137842057 CTGTGTCTAGTTCTGAACCCTGG - Intergenic
963356045 3:144209749-144209771 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
963629928 3:147720299-147720321 CAGTATCTGCTTCTGAAACCAGG - Intergenic
965050321 3:163638531-163638553 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
965671950 3:171156734-171156756 CAGTATCTGCTGCTAAAGGCAGG + Intronic
965996174 3:174885339-174885361 CAGTATCTGCTTCTGAAGCCGGG + Intronic
969784329 4:9442175-9442197 CTGTCAGTACTGCTGAAGGCAGG + Intergenic
971101375 4:23469303-23469325 CAGTATCTGCTTCTAAAGCCAGG + Intergenic
971979671 4:33735768-33735790 CTGTATCTGCTTCTGAAACCAGG + Intergenic
972192531 4:36612366-36612388 CATTATCTGCTTCTGAAGCCAGG - Intergenic
972805583 4:42527124-42527146 CAGTATCTGCTTCTGAAGCCAGG - Intronic
973102632 4:46292230-46292252 CAGTATCTGCTTGTGAAGCCTGG - Intronic
974458786 4:62162325-62162347 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
975837589 4:78440991-78441013 ATGTGTATGCTGCTGAAGCCAGG - Intronic
975982998 4:80180178-80180200 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
976034567 4:80798663-80798685 CAGTATCTGCTTCTAAAGCCAGG + Intronic
977430381 4:96925324-96925346 CAGCATCTTCTTCTGAAGCCGGG - Intergenic
977626987 4:99198227-99198249 CAGTATCTGCTTCTGATGCCTGG + Intergenic
977702118 4:100032787-100032809 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978342223 4:107730524-107730546 CAGTATCTTCTTCTGAAGCTGGG + Intergenic
978772348 4:112469238-112469260 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
978989773 4:115066135-115066157 CTGTCTCTACTACTGAAATCAGG + Intronic
979766639 4:124471887-124471909 TAGTATCTGCTTCTGAAGCCAGG - Intergenic
981834476 4:149039561-149039583 CATTATCTGCTTCTGAAGCCAGG - Intergenic
982526825 4:156489505-156489527 CAGTATCTGCTTCTGAAGCCGGG - Intergenic
982835125 4:160113648-160113670 CATTATCTGCTTCTGAAGCCAGG - Intergenic
983184689 4:164688707-164688729 CAGTATCTACTTCTGAAGCTGGG - Intergenic
986037420 5:3953383-3953405 CAGTATCTTCTTCTGAAGCTGGG + Intergenic
986742606 5:10717195-10717217 CAGTATCTGCTTCTGAAGCCCGG - Intronic
987152784 5:15058765-15058787 CAGTATCTTCTTCTGAAGCCAGG - Intergenic
987504029 5:18746948-18746970 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
987578737 5:19761244-19761266 CAGTATCTGCTTCTGAAGCCAGG + Intronic
987657486 5:20824552-20824574 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
987885244 5:23805002-23805024 CAGTATCTGCTTCTGAAGCCGGG - Intergenic
988080186 5:26404324-26404346 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
988107388 5:26769581-26769603 CAGTATCTTCTTCTGAAGCTGGG - Intergenic
988267861 5:28974282-28974304 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
988766058 5:34379393-34379415 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
989045692 5:37271146-37271168 CAGTATCTGTTTCTGAAGCCAGG + Intergenic
989097396 5:37794087-37794109 CAGTATCTGCTTCTGAAGTCAGG - Intergenic
991033160 5:62103012-62103034 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
991520614 5:67493254-67493276 CAGTATCTACTGTTGGAACCAGG + Intergenic
993319471 5:86455705-86455727 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
994291763 5:98034890-98034912 CAGTAGCTGCAGCTGAAGCCAGG + Intergenic
994836760 5:104865239-104865261 CATTATCTGCTTCTGAAGCCAGG - Intergenic
994958085 5:106561425-106561447 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
994984794 5:106918632-106918654 CAGTATCTACTTCTGAAGCCAGG + Intergenic
995279455 5:110316814-110316836 CAGTATCCGCTTCTGAAGCCAGG + Intronic
995776680 5:115730582-115730604 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
998290724 5:140911505-140911527 CAGTATCTGCTTCTGAAGCTAGG + Intronic
999721780 5:154403983-154404005 CTGGATTGTCTGCTGAAGCCTGG - Intronic
1000223676 5:159237512-159237534 CAGTATCTGCTTCTGGAGCCAGG + Intergenic
1000416602 5:160991021-160991043 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1000641342 5:163706102-163706124 CTGTTTCTACTGTGGAAGGCTGG + Intergenic
1000705382 5:164504184-164504206 CTGTATCTTCTATTGAGGCCAGG - Intergenic
1000730393 5:164828046-164828068 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1001238064 5:170046380-170046402 CTGCTTGTACTGCAGAAGCCTGG + Intronic
1001384423 5:171326756-171326778 ATGTATCAACTGCAGAAGCGTGG + Intergenic
1003696281 6:8409009-8409031 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1003758220 6:9147135-9147157 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1004824688 6:19406137-19406159 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1005622852 6:27635931-27635953 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1006061969 6:31430241-31430263 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1008079740 6:47181277-47181299 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1008957415 6:57230917-57230939 CTGTATCTCCTGGTAAAGCCAGG + Intergenic
1009806101 6:68603894-68603916 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1010325702 6:74559510-74559532 CAGTATCTGCTACTGAAGCTGGG + Intergenic
1010552055 6:77235808-77235830 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1010581096 6:77596657-77596679 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1010818211 6:80385194-80385216 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1011068655 6:83358417-83358439 CAGTATATGCTTCTGAAGCCAGG - Intronic
1012344204 6:98167421-98167443 CAGTACCTGCTTCTGAAGCCAGG - Intergenic
1012730098 6:102871429-102871451 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1012820431 6:104080036-104080058 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1013309531 6:108880343-108880365 CTGAATCAACTGCTGTAGCTGGG - Intronic
1014418895 6:121216770-121216792 CAGTATCTTCTTCTGAAGCCAGG - Intronic
1014456220 6:121637521-121637543 CAGTATCTTCTTCTGAAGCCGGG + Intergenic
1014534587 6:122599548-122599570 CAGTATCTGCTTTTGAAGCCAGG + Intronic
1014631358 6:123794415-123794437 CAGTATCTGCTTCTGAAGACAGG - Intergenic
1015475354 6:133654410-133654432 CAGTATCTGCTTCTGAAGCCTGG - Intergenic
1016143937 6:140646649-140646671 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1016147677 6:140695623-140695645 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1016219825 6:141654656-141654678 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1016576634 6:145575509-145575531 CAGTATCTGCTTCTGAAGCCGGG + Intronic
1016582162 6:145640780-145640802 CTGTATGTGCTACTGAAGCCTGG - Intronic
1016953253 6:149601689-149601711 CTGTAGCTACTGCTTTAGCAAGG + Exonic
1018107710 6:160504719-160504741 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1018599483 6:165524616-165524638 TTGTATCTGCTTCTGAAGCCAGG - Intronic
1019926143 7:4193766-4193788 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1021286998 7:18792972-18792994 CTCTATCTACTACTGGGGCCTGG + Intronic
1022226720 7:28371163-28371185 CTGAATCTTCTGCTGCTGCCCGG - Intronic
1024040258 7:45547577-45547599 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1025761774 7:64402577-64402599 CCGTATTTGCTTCTGAAGCCAGG - Intergenic
1027407189 7:77873973-77873995 CAGTATCTGCTTCTGAAGCCAGG + Intronic
1029825990 7:103195040-103195062 AAGTATCTTCTGCTGTAGCCTGG + Intergenic
1030368167 7:108670042-108670064 CAGTATCTGCTTCTGAAGCCTGG - Intergenic
1030458472 7:109802122-109802144 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1032153499 7:129449851-129449873 CAGTATCTGCTTCTGAAGCTGGG + Intronic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1033075826 7:138249792-138249814 CCGTATCTGCTTCTGAAGCCGGG - Intergenic
1034169501 7:149052111-149052133 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1034217676 7:149420878-149420900 CTGCATCCAATGCTGAAGCCAGG + Intergenic
1036483582 8:9159707-9159729 CTGGAGCTACTGCTCAAGGCAGG + Intronic
1036834711 8:12051963-12051985 CTGTCAGTACTGCTGAAGGCAGG - Intergenic
1036856554 8:12298527-12298549 CTGTCAGTACTGCTGAAGGCAGG - Intergenic
1037505057 8:19521318-19521340 CTGTCTTTAGTGCTGTAGCCTGG - Intronic
1040916519 8:52570736-52570758 CAGTATCTGCTTCTGAAGTCAGG + Intergenic
1041734555 8:61095852-61095874 CTGTATCTGCAGCTGAAATCAGG - Intronic
1042287641 8:67131721-67131743 CTGTATCTATTTCTTAAGCTAGG - Intronic
1043100562 8:76039987-76040009 CGGTATCTGCTTCTGAAGCTAGG + Intergenic
1043260331 8:78187065-78187087 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1043539404 8:81242643-81242665 CAGTAACTGCTGCTGAAGCTGGG + Intergenic
1043733625 8:83717319-83717341 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1044115443 8:88328375-88328397 CTGTGCCTACTCCTCAAGCCTGG - Intergenic
1044633814 8:94302708-94302730 CAGTTTCTGCTTCTGAAGCCAGG + Intergenic
1046197189 8:110881348-110881370 CAGTGTCTGCTTCTGAAGCCAGG - Intergenic
1048678731 8:136814542-136814564 CTGAACCTGCTGCTGAATCCTGG - Intergenic
1051072372 9:13187102-13187124 CTGTATGTTTTGCTGATGCCAGG - Intronic
1051135007 9:13910211-13910233 CTTTTTCTCCCGCTGAAGCCTGG - Intergenic
1051881749 9:21847724-21847746 CAGTATCTGCTGCTGGAGCTGGG - Intronic
1052151814 9:25126430-25126452 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1052227236 9:26105458-26105480 CAGTATCTGCTTCTGAAGCCAGG - Intronic
1052284265 9:26767221-26767243 CTGTGGCTGCTGCTGAAGCTGGG - Intergenic
1052368249 9:27637930-27637952 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1053435950 9:38074575-38074597 CTCTCTCTCCTGCTGCAGCCAGG + Intergenic
1056752254 9:89360939-89360961 CTGTCTCTTCTCCTGAAGTCTGG - Intronic
1057316196 9:93970217-93970239 CAGTATCTGCTTCTGAACCCGGG - Intergenic
1059066535 9:111091608-111091630 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1059651077 9:116316630-116316652 CTGTTTCTACCTCTGAAGCCTGG + Intronic
1061385400 9:130286615-130286637 CTGGACCAACTGCTGAACCCAGG - Intronic
1062546914 9:137067977-137067999 CTGTACCCACTTCTGTAGCCTGG - Intronic
1186294786 X:8137242-8137264 CAGTATCTGCTTCTGAAGCTGGG + Intergenic
1186470180 X:9814999-9815021 CAGTATCTGCTTTTGAAGCCGGG + Intronic
1187168812 X:16830801-16830823 CGGTTTCATCTGCTGAAGCCAGG - Intronic
1191742904 X:64454215-64454237 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1191758989 X:64626979-64627001 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1191769857 X:64743023-64743045 CAGTACCTACTTCTGAAGCCAGG + Intergenic
1191928718 X:66344640-66344662 CTGTAAAAAATGCTGAAGCCAGG - Intergenic
1192298097 X:69870905-69870927 CAGTATCTGCTTCTGAAGTCAGG + Intronic
1192673614 X:73171289-73171311 CAGTATCTGCTTCTGAAACCAGG + Intergenic
1192891266 X:75393343-75393365 CAGTATCTGCTTCTGAAGCCAGG + Intronic
1192995859 X:76512666-76512688 CAGTATCTGCTTCTAAAGCCAGG - Intergenic
1193156010 X:78174924-78174946 CAGTAACTGCTTCTGAAGCCAGG + Intergenic
1193297424 X:79849778-79849800 CAGTATCTTCTTCTGAAGCTGGG - Intergenic
1193832568 X:86307200-86307222 CAGTATCTGCTTCTGAAGCCAGG - Intronic
1193869683 X:86781267-86781289 CAGTATCTCCTTCTGAAGCCGGG + Intronic
1193876919 X:86872412-86872434 CAGTATCTGCTTCTGAAGCCAGG - Intergenic
1193904223 X:87223637-87223659 CAGTGTCTGCTTCTGAAGCCGGG - Intergenic
1194174706 X:90631400-90631422 AAGTATCTGCTTCTGAAGCCAGG - Intergenic
1194179960 X:90698875-90698897 CAGTATCTACTTCTGAAGATGGG + Intergenic
1194342939 X:92728183-92728205 CCGTGTCTGCTTCTGAAGCCAGG - Intergenic
1194491449 X:94555038-94555060 CAGTATCTGCTTCTCAAGCCAGG - Intergenic
1194513786 X:94825160-94825182 CAGTATCTGCTTCTGATGCCAGG + Intergenic
1194833561 X:98655883-98655905 CAGTATCTGCTTCTGAAGCCGGG - Intergenic
1194849544 X:98854386-98854408 CAGTACCTGCTTCTGAAGCCAGG + Intergenic
1195749234 X:108147595-108147617 CAATATCTGCTTCTGAAGCCTGG + Intronic
1195782752 X:108482782-108482804 CAGTATCTCCTTCTGAAGCCAGG + Intronic
1196372700 X:114997059-114997081 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1197097095 X:122609920-122609942 TAGTATCTGCTTCTGAAGCCAGG - Intergenic
1197245483 X:124162234-124162256 CAGTATCTCCTTCTGAAGACGGG + Intronic
1197380310 X:125730463-125730485 CAGTATCTGCTTCTGAAGCCAGG + Intergenic
1197404716 X:126036269-126036291 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1197409584 X:126098750-126098772 CAGTATCTGCTTCTGAAGCGAGG + Intergenic
1197591484 X:128416430-128416452 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1197956172 X:131950955-131950977 CAGTATCTGCTTCTGAAGCTGGG - Intergenic
1198700863 X:139396978-139397000 CAGTATCTGCTTCTAAAGCCGGG - Intergenic
1198704157 X:139429202-139429224 CTGTATTTACTGGTGGATCCTGG + Intergenic
1198933626 X:141884890-141884912 CAGTATCTGCTTCTGGAGCCAGG - Intronic
1199627467 X:149753509-149753531 CAGTATCTGCTTCTGAAGCCGGG + Intergenic
1199680771 X:150223075-150223097 CTGTATTTGCTGTTGAAGGCAGG - Intergenic
1200340678 X:155392005-155392027 CAGTATCTGTTTCTGAAGCCAGG + Intergenic
1200520918 Y:4209121-4209143 AAGTATCTGCTTCTGAAGCCAGG - Intergenic
1200651300 Y:5844849-5844871 CCGTGTCTGCTTCTGAAGCCAGG - Intergenic
1201463439 Y:14254000-14254022 CTGTATCTACTACTGTATCTAGG + Intergenic