ID: 1135992871

View in Genome Browser
Species Human (GRCh38)
Location 16:27228501-27228523
Sequence GGGTGCCGTGATGGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 3, 2: 2, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992871 Original CRISPR GGGTGCCGTGATGGATCTGG AGG (reversed) Intronic
900833422 1:4981260-4981282 AGGTGCTGTGATTGCTCTGGTGG - Intergenic
904021404 1:27468837-27468859 GGGTGCCGTGGTGGAGGCGGAGG + Intronic
915396618 1:155590031-155590053 GGGTGCAGTGTTGGAGGTGGGGG + Intergenic
916057111 1:161075296-161075318 GGATGCCTTGAGGGAACTGGAGG + Intronic
918148689 1:181780248-181780270 GGTTGCTGTGAGGGATCTGAGGG + Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
1063941185 10:11131355-11131377 AGGTGCCGTGATGTTTCTGTAGG + Intronic
1066153553 10:32650792-32650814 GGGTGCAGTGTGGGATCTGAAGG + Intronic
1069875345 10:71559627-71559649 GGGTGCTGAGTTGGCTCTGGAGG + Intronic
1070151517 10:73808165-73808187 GGGGGCCGAGGTGGAACTGGAGG + Exonic
1072493085 10:95928082-95928104 GGGGGACCTGAGGGATCTGGAGG - Intronic
1073650815 10:105356047-105356069 GGGTTCAGTGATGCATCTTGCGG + Intergenic
1075634626 10:124022145-124022167 TGGTGCAGAGATGGACCTGGAGG - Intronic
1076200430 10:128553401-128553423 GGGTGCCGTGATGCAGCTGCTGG - Intergenic
1079353643 11:19713491-19713513 GGGTGCCGGGATGGGAATGGGGG - Intronic
1082317008 11:50741970-50741992 GAGTGCCTTGAGGGATATGGTGG + Intergenic
1082737616 11:56873952-56873974 GGATGCCCTGCCGGATCTGGAGG - Intergenic
1082861262 11:57858679-57858701 GGGTGCAGTGTTGGCTCAGGCGG - Intergenic
1084041755 11:66546722-66546744 GGGCGCCGGGGTGGATCTCGCGG - Exonic
1084175594 11:67420764-67420786 GGCCGCCGTGCTGGCTCTGGAGG + Exonic
1084208134 11:67607717-67607739 TGGTGCCGTGATGCAGCTGTGGG + Intronic
1084485117 11:69443613-69443635 GGCGGCCGTGATGGGGCTGGCGG - Intergenic
1086434599 11:86769154-86769176 GGGTGTAGTGATGGTTCTGCAGG - Intergenic
1087918533 11:103838286-103838308 GGCTGCATGGATGGATCTGGAGG + Intergenic
1090401514 11:126452497-126452519 GGGTGCCGGGCTGGGGCTGGAGG + Intronic
1095563696 12:43595487-43595509 GGGCACCGTGATGGATCAGAAGG + Intergenic
1097245250 12:57604570-57604592 GGGTGGCGTCATGGAACTGAGGG - Intergenic
1100591581 12:96035169-96035191 GGGTGCTGTGAGAGATCTGGGGG + Intronic
1104823510 12:131692690-131692712 AGGTGACGTCAGGGATCTGGTGG - Intergenic
1104896872 12:132168979-132169001 GAGTGCACTGAGGGATCTGGGGG + Intergenic
1105003583 12:132707051-132707073 GGATGCCGTGAAGGATGTGGCGG + Intergenic
1112418761 13:99228241-99228263 GGGTGTTGTGATGGTGCTGGTGG + Intronic
1113593981 13:111518421-111518443 GAGTGTGGTGATGGATTTGGAGG + Intergenic
1113900079 13:113791945-113791967 GGGTGCCGGCCTGGATCAGGGGG - Intronic
1113948193 13:114056627-114056649 GGGTCCCGTGAGGCTTCTGGTGG + Intronic
1115885652 14:37968950-37968972 GGGTGGGGTGAGGGAACTGGTGG + Intronic
1121676223 14:95755065-95755087 AGGTGCCATGATGGAGGTGGTGG + Intergenic
1121867642 14:97377616-97377638 TGGTGCCCTGATTGGTCTGGGGG + Intergenic
1122298995 14:100721433-100721455 GGGTGCAATGATGGATTTGAAGG - Intergenic
1123125470 14:105942917-105942939 GGATACCCTGATGGATCCGGAGG - Intergenic
1124790072 15:32718602-32718624 GGGCGCCGCGCTGGGTCTGGGGG + Intronic
1125504221 15:40257711-40257733 TGGGGCCCTGATGGCTCTGGTGG + Intronic
1126172339 15:45705038-45705060 GGGTGCCGTGGCGGAGCGGGGGG - Intergenic
1127024717 15:54791531-54791553 GTGTGCTGGGAGGGATCTGGTGG + Intergenic
1132493220 16:246060-246082 GGGTGCGGTGGTGGGTGTGGTGG + Intronic
1133031850 16:3014786-3014808 GGGTGCAGTGTTGGAGGTGGGGG + Exonic
1134051628 16:11141499-11141521 GGGGACCGTGGGGGATCTGGAGG + Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1138247348 16:55477752-55477774 GGGTGAGGGGATGGAGCTGGAGG - Intronic
1139633713 16:68245563-68245585 GGGTCTCGTGGTGGATCTGTCGG + Intronic
1141017231 16:80461892-80461914 GGGTGCAGAGATGGGTCAGGTGG - Intergenic
1142161852 16:88561898-88561920 GGGGGCCATGATGGAAGTGGGGG + Intergenic
1144331154 17:14225150-14225172 GGGTGCAGTAATGAATATGGAGG + Intergenic
1144573062 17:16412415-16412437 GGATGTGGTGATGGCTCTGGAGG + Intergenic
1144771701 17:17763127-17763149 GGATGCAGGGAAGGATCTGGGGG - Intronic
1144823216 17:18089843-18089865 GGGTGCAGTGATGGGACAGGAGG + Intronic
1147359220 17:39920853-39920875 GGGGGCTGTGAGGGAACTGGCGG - Intergenic
1148230028 17:45926693-45926715 GTGTGGTGTGATGGTTCTGGAGG + Intronic
1155193760 18:23453647-23453669 GGGTGCCGGGATGGGGATGGAGG + Intronic
1159369441 18:67512724-67512746 TGGTGCCATGATGGATGTGTGGG - Exonic
1160869640 19:1271392-1271414 GGGTACCGTGGTGGCTCTGCCGG + Exonic
1161072535 19:2269959-2269981 GGGTGCGGAGTTGGATTTGGGGG + Intronic
1162158642 19:8696479-8696501 GGTCTCTGTGATGGATCTGGGGG + Intergenic
1163753717 19:19093995-19094017 AGATGGGGTGATGGATCTGGGGG + Intronic
1166897670 19:46034052-46034074 GGCTGCAGTGCTGAATCTGGGGG - Intergenic
935065535 2:99644037-99644059 GGGTGCTGTGCTGGGGCTGGGGG - Intronic
936008873 2:108912083-108912105 GGGTGCTCTGAGGGCTCTGGAGG + Intronic
940851523 2:158691700-158691722 GGGTGCCCGGGTGGGTCTGGTGG - Intergenic
943955681 2:194186410-194186432 GGGTGCATGGATGGAACTGGAGG - Intergenic
944488890 2:200237134-200237156 GGGAGACGTGATGGAACTGAAGG + Intergenic
947931830 2:233971223-233971245 GTGTGCTATGATAGATCTGGAGG + Intronic
948507129 2:238435819-238435841 GGGGGCCGAGGTGGATCTGGTGG + Exonic
949031705 2:241800176-241800198 GGGTGCAGTGATGGGTCTGGTGG + Intronic
1172008620 20:31833770-31833792 GGGGGCACTGATGGCTCTGGGGG + Exonic
1173586460 20:44186802-44186824 GGGTGCAGTGGTGAGTCTGGGGG - Exonic
1173869441 20:46332327-46332349 GGGAGCGGTGGTGGATCTGGGGG + Intergenic
1175194440 20:57233238-57233260 GGGTGCTGGGATGTAACTGGAGG - Intronic
1175624482 20:60479015-60479037 GGGTGCTGGGATGCATGTGGAGG - Intergenic
1179804928 21:43831385-43831407 GGGTCCTGTGGAGGATCTGGGGG + Intergenic
1180088693 21:45523099-45523121 GGGAGCCGTGATGGAGCATGGGG - Intronic
1183739502 22:39662174-39662196 GGGGCCCGTGATGAATGTGGTGG - Exonic
1184483053 22:44759320-44759342 GAGGGCTGTGATGGACCTGGGGG + Intronic
1185179449 22:49350637-49350659 GGGTGCCCTGGAGGATGTGGAGG - Intergenic
1185260004 22:49856437-49856459 GGTTGCCCTGAAGGGTCTGGGGG + Intronic
952557863 3:34553876-34553898 GGGTGTGGTGATGGAGGTGGGGG - Intergenic
954360569 3:50120601-50120623 TGATGCCGTGAGGGCTCTGGAGG - Intergenic
954396627 3:50296679-50296701 GGGGGCCCTGATGGAACTGGGGG + Exonic
954983770 3:54771057-54771079 GGTTGATGTGGTGGATCTGGGGG + Intronic
955820320 3:62889657-62889679 GAGTGCCTTGCTGGATTTGGGGG + Intergenic
956465027 3:69511579-69511601 GGGTGGCCTGAAGGATCTAGAGG - Intronic
963901774 3:150740046-150740068 GGGTGCCGTGAGGGCCCTGGAGG + Intergenic
986540922 5:8843049-8843071 AGCTGCCGTGAGGGAGCTGGTGG - Intergenic
987373901 5:17217435-17217457 GGGTGGGGAGATGGAGCTGGAGG + Intronic
992746862 5:79829102-79829124 TGGTACTGTGTTGGATCTGGTGG - Intergenic
994744458 5:103661772-103661794 GTGTGCTGTGCTGGATCTGAGGG + Intergenic
999602002 5:153277227-153277249 GTGTGCCATGCTGTATCTGGTGG + Intergenic
1009025731 6:57998362-57998384 GGGAGCAGTGATGGAGGTGGTGG - Intergenic
1011161807 6:84399579-84399601 GGGTGAAGTGATGGAGGTGGAGG - Intergenic
1019917536 7:4143442-4143464 GGGTGCCAGGAGGGCTCTGGGGG - Intronic
1020489056 7:8756564-8756586 GGAGGCCGCGATGGATCAGGAGG - Intergenic
1022011239 7:26309740-26309762 GGGTGCCCTGTTGGATGTAGGGG + Intronic
1025282699 7:57639671-57639693 GGGTGCAGGCATGGAACTGGAGG - Intergenic
1025302018 7:57825746-57825768 GGGTGCAGGCATGGAACTGGAGG + Intergenic
1027972758 7:85106916-85106938 GTGTCCTGTGAGGGATCTGGTGG - Intronic
1029196583 7:98809762-98809784 GGCCCCCGTGATGGAACTGGTGG + Intergenic
1029406074 7:100374655-100374677 GGGGGCGGGGCTGGATCTGGAGG - Intronic
1031954596 7:127929494-127929516 GGGTGCAGTGCTGGGTCTGCAGG - Intronic
1034440513 7:151083443-151083465 AGGGGCCGCGATGGAGCTGGGGG - Intronic
1035395568 7:158532728-158532750 GTGTGCCGTGGTGTGTCTGGAGG - Intronic
1035596695 8:863901-863923 GGGTGCCGCAATGGACCTGGGGG - Intergenic
1041640700 8:60197629-60197651 GGGGGTTGTGATGGATATGGAGG - Intronic
1041946687 8:63451849-63451871 GAGTGAGGTGATGGATTTGGGGG - Intergenic
1042040452 8:64583479-64583501 GGGAGCTGTGATGGATCTGTTGG + Exonic
1042964256 8:74334249-74334271 GGGTGCAGGGATGGATGGGGAGG - Intronic
1048071608 8:131027494-131027516 GGGTGGCTTGATGAATCTTGGGG + Intronic
1049757802 8:144318545-144318567 GGGTGCCCTGACGGAGCAGGCGG - Exonic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1057843652 9:98505731-98505753 GGGTGGAGTGATGCATCTGCCGG + Intronic
1060399805 9:123341807-123341829 GGGTGCCGTGAAGTCTCTGAGGG + Intergenic
1060630247 9:125151258-125151280 GGGAGATGTGAAGGATCTGGTGG + Intronic
1061053512 9:128209618-128209640 GAGTTCCGTGGTGGATGTGGAGG + Intronic
1062423496 9:136495271-136495293 GGGGGCCGGGGTGGTTCTGGAGG + Exonic
1062562521 9:137147973-137147995 GGGGGCCGGGGTGGAGCTGGGGG - Intronic
1189590146 X:42502185-42502207 GGGTGCCACGGTGGATCTGAAGG + Intergenic
1192447677 X:71223025-71223047 GGGTGCGGCGATGGACCGGGCGG + Intronic
1192770753 X:74186895-74186917 GGGTGCCATGACAGGTCTGGAGG - Intergenic
1195032930 X:100944263-100944285 GGGTGGCATGATGGACATGGAGG + Intergenic
1200072426 X:153535783-153535805 GGGTTCCCGAATGGATCTGGGGG + Intronic
1200226818 X:154422127-154422149 GGTTGCCCAGATGGAGCTGGGGG + Intergenic