ID: 1135992890

View in Genome Browser
Species Human (GRCh38)
Location 16:27228556-27228578
Sequence GGTGCTGTGATGGATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 2, 1: 1, 2: 2, 3: 22, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992890_1135992907 29 Left 1135992890 16:27228556-27228578 CCCTCCAGATCCATCACAGCACC 0: 2
1: 1
2: 2
3: 22
4: 214
Right 1135992907 16:27228608-27228630 CCTCCCCTCCAGATCCATCATGG 0: 4
1: 2
2: 17
3: 81
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992890 Original CRISPR GGTGCTGTGATGGATCTGGA GGG (reversed) Intronic
900156279 1:1204530-1204552 GTTGCTGGGATGGATGAGGAGGG + Intronic
900843510 1:5077333-5077355 GGTGCTGTTGTGGCTTTGGAGGG - Intergenic
903656551 1:24952311-24952333 GGTGAGATGATGCATCTGGAAGG - Intronic
903765166 1:25729310-25729332 GGACCTGTGATGGATCGGGAAGG - Intronic
903767500 1:25744115-25744137 GGTCCTGTGATAGAACAGGAAGG + Intronic
905852760 1:41286489-41286511 GGGGCTGGTATGGACCTGGAAGG - Intergenic
905880047 1:41457450-41457472 GGAGCAGGGATGGGTCTGGAAGG - Intergenic
912860091 1:113206561-113206583 GAGGCTGTGCTGGGTCTGGAAGG + Intergenic
912892436 1:113548914-113548936 GCTAATGTGTTGGATCTGGATGG + Intronic
913150038 1:116032639-116032661 AGTGCTGTGATGGTTCTGTGGGG - Intronic
915102951 1:153513814-153513836 GGAGAAGTGATGGAGCTGGATGG - Intergenic
919602606 1:199641046-199641068 GTTGCTGCCATGGTTCTGGATGG + Intergenic
920519867 1:206615368-206615390 AATTCTTTGATGGATCTGGATGG + Intergenic
920684939 1:208102186-208102208 GGTGTTGGGAGGGCTCTGGAGGG - Intronic
920762466 1:208798591-208798613 GGTGGTGGGATGAATTTGGAGGG + Intergenic
920849701 1:209620327-209620349 GGTGCTATGATGGCCATGGAAGG + Intronic
922171409 1:223158921-223158943 TGTCCAGAGATGGATCTGGATGG - Intergenic
922747212 1:228051075-228051097 GATGCTGTGGTGTAGCTGGATGG - Intronic
923549838 1:234954790-234954812 TGGGCTGTGATGAGTCTGGATGG + Intergenic
1063466569 10:6249389-6249411 AGTGCTGTGATGAACATGGAAGG - Intergenic
1064739118 10:18413925-18413947 GGTGTTGTGAGGAATCTGAATGG + Intronic
1065375511 10:25036560-25036582 GGTGCAGTGAAGGATGAGGAAGG + Intronic
1065678362 10:28203001-28203023 CGGGCTGTGATGGAGATGGATGG - Intronic
1066153554 10:32650793-32650815 GGTGCAGTGTGGGATCTGAAGGG + Intronic
1067088563 10:43255238-43255260 GGTGGTGTGAGGGGCCTGGAGGG - Intronic
1067375740 10:45726826-45726848 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1067883450 10:50067514-50067536 GCTGCTGTGAAGGAGCTGGTAGG - Intergenic
1073095505 10:100977286-100977308 GGTGCTGAGAAGGAGCTGGATGG + Intronic
1074205672 10:111280882-111280904 GGGGCTGTGATGGGCCTGGAAGG + Intergenic
1074836296 10:117299005-117299027 AGGACTGTGATGGATATGGAGGG - Intronic
1075651091 10:124128722-124128744 GGTGCTGGGCTGGCTCTGCAGGG - Intergenic
1076532612 10:131154834-131154856 CGTGCTGTGCTGGAACTGAAGGG + Intronic
1078003472 11:7515519-7515541 GGTGATGTGATGGACCTCAAAGG + Intronic
1079382328 11:19948977-19948999 GGAGATGAGATGGACCTGGAAGG + Exonic
1083690262 11:64404015-64404037 GGTGCTGTGATGTCTCCAGAGGG - Intergenic
1084665326 11:70573284-70573306 GGGGCTGTGATGGAGCTGGGTGG + Intronic
1084908047 11:72363954-72363976 GGTGCTGTGATGCCTCAGCAGGG - Intronic
1085740780 11:79076661-79076683 TGGGCTTGGATGGATCTGGAAGG + Intronic
1089959050 11:122599667-122599689 GGTGGTGGGAGGGATCAGGAGGG - Intergenic
1090271151 11:125387253-125387275 GGAGCTGGGATGGACCTGGGGGG + Intronic
1090551265 11:127822408-127822430 GTAGCTCTGATGGTTCTGGAAGG + Intergenic
1090594872 11:128310477-128310499 GTGGCAGTGAAGGATCTGGAAGG + Intergenic
1091482215 12:844773-844795 GGTGCTGAGATAAATGTGGAGGG + Intronic
1092090076 12:5797182-5797204 GGGCCTGTGATGGCTCAGGAAGG + Intronic
1092500541 12:9041978-9042000 GGTGATGAGAAGAATCTGGAAGG + Intergenic
1096519813 12:52178551-52178573 GGTGCTGCGCTGGAGCCGGAAGG - Intronic
1096524361 12:52201717-52201739 GGTGGTGTGAGGGAGATGGAAGG + Intergenic
1096847907 12:54418227-54418249 GGTGCTGGGATGTGTCGGGAGGG - Intronic
1097693279 12:62754128-62754150 AGTACTGTTAGGGATCTGGAAGG + Intronic
1097836120 12:64274220-64274242 GGTCCTGTGATGCAGCTGCAGGG + Intronic
1098595852 12:72272635-72272657 GGCGGTGTGATGGCCCTGGACGG + Intronic
1098602515 12:72348771-72348793 GGTACTTTGATGGATATAGATGG + Intronic
1098823362 12:75261441-75261463 GGTGGTGTGATGGGTTGGGAAGG - Intergenic
1100947186 12:99799405-99799427 GGTGCTGTGATTGAGACGGAAGG - Intronic
1101236616 12:102796077-102796099 GGTGCTCTGGAGGATCTGGAAGG + Intergenic
1102024169 12:109704012-109704034 GGTGCTGGGATGGAGGGGGAGGG + Intergenic
1103304532 12:119953473-119953495 ATTGCTGTGTTGGATCTGAAGGG + Intergenic
1104622912 12:130331729-130331751 GGTGCTGAGATGGATAGGGCAGG + Intergenic
1104751910 12:131245341-131245363 GGTCCTGTGATGGACATGGGAGG - Intergenic
1104779982 12:131413734-131413756 GGTCCTGTGATGGACATGGGAGG + Intergenic
1105700715 13:22934445-22934467 GGGGCTGTGATGGGGGTGGATGG - Intergenic
1105853541 13:24357518-24357540 GGGGCTGTGATGGGGGTGGATGG - Intergenic
1106976598 13:35225208-35225230 AGTGCTGTCCTGGATCTTGAAGG + Intronic
1112036431 13:95500848-95500870 GTTGCTGGGATGGATTTGAATGG + Intronic
1116492901 14:45526997-45527019 GGTGCAGTGTGGGATCTGAAGGG - Intergenic
1117344250 14:54817401-54817423 TGTGCTCTGCTGGAACTGGACGG - Intergenic
1118088080 14:62441570-62441592 GGTGCTGTGTTGGCTGTGCACGG + Intergenic
1118736858 14:68707152-68707174 GATGGTGGGAAGGATCTGGAAGG - Intronic
1119309189 14:73632423-73632445 GGTTCTGGAATGGTTCTGGAAGG - Intergenic
1121042626 14:90761371-90761393 GGCCCTGTGGTGGATCTGGTGGG - Intronic
1122826432 14:104373027-104373049 GGTGCCGTGTTGGCCCTGGATGG - Intergenic
1123009810 14:105343194-105343216 CGTGATAGGATGGATCTGGAAGG - Intronic
1123482358 15:20644067-20644089 GGTGCTGGGATAGACCAGGAGGG - Intergenic
1124640551 15:31393497-31393519 GGTGCTGGGATGGGGCTGGATGG - Intronic
1127024718 15:54791532-54791554 TGTGCTGGGAGGGATCTGGTGGG + Intergenic
1127868311 15:63048946-63048968 GGTGTTGAGAAGGTTCTGGAAGG + Intronic
1127936121 15:63640325-63640347 GGTGGTGTGGTGGCACTGGAGGG + Exonic
1128103800 15:65028598-65028620 GCTGCTGTGAAGTATCTGTAGGG + Intronic
1129458658 15:75689058-75689080 TGTGCTGCGGTGGATCTGTATGG + Exonic
1129725135 15:77897814-77897836 TGTGCTGCGGTGGATCTGTATGG - Intergenic
1130197832 15:81797574-81797596 TGTGGTTTGATGGATATGGACGG - Intergenic
1134139581 16:11706425-11706447 TGTGCTGTGATGGGTCTAGATGG - Intronic
1135992870 16:27228500-27228522 GGTGCCGTGATGGATCTGGAGGG - Intronic
1135992890 16:27228556-27228578 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992909 16:27228612-27228634 GGTACCATGATGGATCTGGAGGG - Intronic
1135992928 16:27228668-27228690 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992947 16:27228724-27228746 AGTACCATGATGGATCTGGAGGG - Intronic
1135992963 16:27228780-27228802 GGTGCCATGATGGATCTGGAGGG - Intronic
1135992983 16:27228836-27228858 GGTACCATGATGCATCTGGAGGG - Intronic
1135993002 16:27228892-27228914 GTTGCCATGATGGATCTGTAGGG - Intronic
1138103609 16:54274611-54274633 TATGCTGTGAAGTATCTGGAAGG + Intergenic
1138247347 16:55477751-55477773 GGTGAGGGGATGGAGCTGGAGGG - Intronic
1139429899 16:66905455-66905477 GGTTCTGGGCTGGAGCTGGAGGG - Intergenic
1141191704 16:81829824-81829846 GGTGCTGTGGTAGCTGTGGATGG + Intronic
1141399305 16:83733217-83733239 TGTTCTGTGAAGGAGCTGGAGGG - Intronic
1141766266 16:86061778-86061800 AGTGCTGGGAGGGATCTGCATGG + Intergenic
1143689050 17:8545240-8545262 GGTGCTGTGATAGAACTGGGAGG - Intronic
1144761857 17:17711513-17711535 GAGGCTGGGATGGAGCTGGAGGG + Intronic
1144823217 17:18089844-18089866 GGTGCAGTGATGGGACAGGAGGG + Intronic
1145209593 17:21003392-21003414 GGCGATGAGGTGGATCTGGACGG - Intronic
1147217826 17:38911278-38911300 GGTGCCGAGATGGACCTTGAAGG + Intronic
1147882823 17:43665144-43665166 TGTGCTGTGGGGGTTCTGGAAGG + Intergenic
1148230029 17:45926694-45926716 TGTGGTGTGATGGTTCTGGAGGG + Intronic
1148465009 17:47859732-47859754 GGTTGTGTGATGGAAGTGGAAGG + Intergenic
1151142237 17:72004826-72004848 GGAGCTGTGCTGAAGCTGGAGGG + Intergenic
1151948514 17:77332674-77332696 GGGACTGTGATGCACCTGGAGGG - Intronic
1152466920 17:80471710-80471732 GGTACTGTGCTGGATGTGGTGGG - Exonic
1152778822 17:82217529-82217551 GGTGCTTTGAGGGAGCTGGGGGG + Intergenic
1155223240 18:23704298-23704320 GGTGCTGTCTTAGATTTGGACGG - Intronic
1155819640 18:30359225-30359247 AGTGCTGTGCTTGATCTTGAAGG - Intergenic
1156188594 18:34692005-34692027 GGTGCTGTGATTGATAATGAAGG - Intronic
1157152573 18:45232905-45232927 GGTGCTGTGTTGGTTCAGGTGGG + Intronic
1157792004 18:50541192-50541214 GGGGCTGTGCTGGCTGTGGAAGG - Intergenic
1158265867 18:55660102-55660124 GGTGCTGAGATGGATGAGAACGG + Intronic
1160882110 19:1325598-1325620 GGCGCTGGGATGGCTCTGGGAGG + Intergenic
1162060110 19:8089833-8089855 AGTGCGGAGATGGATCTGGGTGG + Intronic
1162158643 19:8696480-8696502 GTCTCTGTGATGGATCTGGGGGG + Intergenic
1164960067 19:32420303-32420325 GCTGCTGTGAAGAATCTGGATGG + Intronic
1166817674 19:45556706-45556728 GGAGCTCTGCTGGAGCTGGAGGG + Intronic
1168322597 19:55518759-55518781 GCTGCTGTGAGGGATGTGGGTGG + Exonic
925281664 2:2689634-2689656 CCTGCTGAGATGGATCGGGAGGG - Intergenic
926044285 2:9698407-9698429 TGTGCTGTCATGGAGCAGGATGG + Intergenic
926323448 2:11765036-11765058 TGGGCTGTGATGGATCCTGATGG + Intronic
929661448 2:43789466-43789488 GGTGCTTTGATGCATTTTGAGGG + Intronic
930301221 2:49618472-49618494 GGTGCTTTCCTGGATCTGGGTGG - Intergenic
932576230 2:72963785-72963807 GTTCCTGTGCTGGATCAGGAGGG - Intronic
932777951 2:74539701-74539723 GGTTCTGGGATGGACATGGATGG + Intronic
933173911 2:79156023-79156045 GGAGCTGTGGTGGGTCTGAAGGG + Intergenic
933760241 2:85667610-85667632 GGTGCTGGGTGGGCTCTGGATGG - Intronic
933893846 2:86792844-86792866 GATGCTTTGAGGGAGCTGGAAGG - Intronic
935312582 2:101800010-101800032 GGTGCTGTCATGAACCTAGAAGG - Intronic
936008874 2:108912084-108912106 GGTGCTCTGAGGGCTCTGGAGGG + Intronic
937381640 2:121382846-121382868 GGTGCTGTGATCCAGTTGGATGG + Intronic
937907564 2:127059626-127059648 GGTGCTGTGATGGACAGGCAGGG - Intronic
940238254 2:151534193-151534215 GGTACTGTGATGGGGCTGGCCGG - Intronic
940589599 2:155704572-155704594 GCTGCTGTGATAGTTCTGCAAGG + Intergenic
941274493 2:163473669-163473691 TGGGCTGTGATAGACCTGGAAGG - Intergenic
943071892 2:183151163-183151185 GGTGCTGTGATGAAAGTGGTAGG + Intronic
946181747 2:217953152-217953174 GGGGCAGTGAGGGATCTGCAGGG + Intronic
946330232 2:219004786-219004808 GGGGCTCTGATGGAGCTGGCTGG - Intronic
947931831 2:233971224-233971246 TGTGCTATGATAGATCTGGAGGG + Intronic
948458099 2:238116614-238116636 GCAGCTGTGAGGGGTCTGGACGG + Intronic
948736332 2:240008746-240008768 GGTGCTGTGTGGGGTATGGAAGG + Intronic
949031706 2:241800177-241800199 GGTGCAGTGATGGGTCTGGTGGG + Intronic
1173001892 20:39110761-39110783 GGAGCTTTGCTGGGTCTGGAGGG + Intergenic
1173013922 20:39208184-39208206 GGGGAGGTGATGAATCTGGAAGG + Intergenic
1174868800 20:54164408-54164430 GGTGCTGGGCTGGTTCTGGCTGG + Intronic
1175192740 20:57222468-57222490 GGTCCTCTCATGGATCTGCAAGG - Intronic
1175624481 20:60479014-60479036 GGTGCTGGGATGCATGTGGAGGG - Intergenic
1175843509 20:62046561-62046583 GGTGATGTGATAGATCCGTATGG - Intronic
1178535710 21:33408557-33408579 GGTGTTGGGATGGGTCAGGAAGG + Intronic
1179027775 21:37694095-37694117 AGTGCTGAGAAGGTTCTGGAGGG + Intronic
1179818162 21:43921300-43921322 GGTGTTATGAAGGATCCGGATGG - Intronic
1180049403 21:45324444-45324466 GGTGGGGTGAAGGATGTGGAGGG + Intergenic
1180745159 22:18083468-18083490 GGAGCTGTGCTGGATGTGGTGGG + Exonic
1181902623 22:26169070-26169092 GGAACTGGGATGTATCTGGAAGG + Intergenic
1182647402 22:31821517-31821539 GGTCTGGTGGTGGATCTGGATGG - Exonic
1184257886 22:43297318-43297340 GCTGCTGTGATGAGTCTGGCTGG + Intronic
1184744744 22:46449740-46449762 GGTGCTGGCATGGAGGTGGAGGG + Intronic
1184759163 22:46535263-46535285 GGAGCTGTTGTGGATCTGGAAGG + Exonic
949365347 3:3274667-3274689 GGTGGGGTGAAGGATCAGGAGGG - Intergenic
950057235 3:10035369-10035391 GTTGCTGTGATGGGTTTGGTAGG + Intronic
950426433 3:12927096-12927118 GGTGCTGGCATGGAGCAGGATGG - Intronic
950827872 3:15844535-15844557 GATTTTGTAATGGATCTGGAAGG + Intronic
953978463 3:47400491-47400513 GGTGATCTCTTGGATCTGGAGGG + Intronic
954287098 3:49626778-49626800 GGTGCTGTGCTGCATCTCAAGGG - Intronic
954612003 3:51949479-51949501 GTTGCAGTGATGGACCAGGAGGG - Intergenic
955360360 3:58268948-58268970 GCTGCTGACTTGGATCTGGAAGG - Intronic
961018948 3:123487971-123487993 GGTGCTGTGATCAATCTGCTGGG - Intergenic
962385110 3:134926638-134926660 GCTGCTGAGATGGGGCTGGAGGG + Intronic
962475085 3:135748297-135748319 GCTGCTGGGCTGAATCTGGAAGG - Intergenic
966885788 3:184377517-184377539 GGTCCTGTGAAGGAACCGGAAGG - Intronic
968942164 4:3644469-3644491 GGTGCTGGGATGGAGTGGGAAGG + Intergenic
974117784 4:57601458-57601480 GGTGATCTGATGGATCAGGCTGG + Intergenic
981716037 4:147753189-147753211 ACTGCTGTGTTGGAGCTGGAAGG + Intronic
985295422 4:188432385-188432407 GGTGGTGTTATGGATCAGGGTGG + Intergenic
986843961 5:11731681-11731703 TTTTCTGAGATGGATCTGGAAGG - Intronic
987373902 5:17217436-17217458 GGTGGGGAGATGGAGCTGGAGGG + Intronic
992381112 5:76238772-76238794 GGTTCTGAGAAGGATGTGGAGGG + Intronic
992482863 5:77168536-77168558 GGAGCAGAGCTGGATCTGGATGG + Intergenic
993606551 5:89997499-89997521 TGAGCTTTGATGGATCTTGAAGG + Intergenic
995743357 5:115377893-115377915 AGCATTGTGATGGATCTGGAAGG + Intergenic
997111732 5:131082549-131082571 GGGGCTGTGAGAGAACTGGAGGG + Intergenic
997229032 5:132229337-132229359 GGTGCTGTTAGGGAGCTAGAAGG - Intronic
997414262 5:133712810-133712832 GATGCTGTGTGGCATCTGGAGGG + Intergenic
997634332 5:135393780-135393802 GGTTCTGTGATTGATCTTGAAGG + Intronic
1001323113 5:170699024-170699046 GGCCCTGGGATGGATGTGGAAGG - Intronic
1001587310 5:172841935-172841957 GGAGCTGTCCTGTATCTGGATGG - Intronic
1001687914 5:173609247-173609269 TGTCCTGAGATGGAGCTGGAGGG + Exonic
1006026591 6:31150901-31150923 AGTGATGTGGTGGATCTGCAGGG - Intronic
1011161806 6:84399578-84399600 GGTGAAGTGATGGAGGTGGAGGG - Intergenic
1013056473 6:106588010-106588032 GCTGCTTTGATGGAGATGGAAGG + Intronic
1016865953 6:148766528-148766550 GGGGCTGTGTTGTACCTGGAGGG + Intronic
1018876323 6:167826147-167826169 GGTGCAGTGCTGGATCTGGACGG - Intergenic
1018876424 6:167826516-167826538 TGGGCGGTGCTGGATCTGGACGG - Intergenic
1019151894 6:170011852-170011874 GGTGATGTGATGGATGAGGCCGG - Intergenic
1019800402 7:3084247-3084269 GATGCTGAGCTGGTTCTGGAGGG + Intergenic
1020021368 7:4871544-4871566 AGTGCTGCGATGGAGCTGGCAGG - Intronic
1021939794 7:25668435-25668457 GGGGCAACGATGGATCTGGATGG - Intergenic
1027972757 7:85106915-85106937 TGTCCTGTGAGGGATCTGGTGGG - Intronic
1029406073 7:100374654-100374676 GGGGCGGGGCTGGATCTGGAGGG - Intronic
1029458293 7:100681937-100681959 GGTGCTGTGGTTGGCCTGGAAGG + Exonic
1030040746 7:105447691-105447713 GGTGCTGTGATGGGTCCACAAGG + Intronic
1032789408 7:135231582-135231604 GGTGTTGAGCTGGATCTGCAAGG + Intergenic
1033245478 7:139713795-139713817 GGTGCTGTGCTGGCTCTGGGAGG - Intronic
1034591506 7:152143880-152143902 GCTGCTGAGAGGGAACTGGATGG + Intronic
1035332535 7:158105675-158105697 GGAGCTGGGATGGAGGTGGATGG - Intronic
1035332564 7:158105836-158105858 GGAGCTGCAATGGAGCTGGATGG - Intronic
1036270294 8:7297564-7297586 GGTGCTTTCGGGGATCTGGAAGG - Intergenic
1036614643 8:10378938-10378960 GGTGCTGTGATGGGGCAGTAGGG - Intronic
1038674209 8:29608769-29608791 GGTACTGTGAGGGATGTGAAAGG - Intergenic
1039334971 8:36578811-36578833 AGTGCTGTGATGAATCTACATGG - Intergenic
1040693099 8:49963045-49963067 GGTGCTGTCATGAAACTGCAAGG - Intronic
1041990892 8:63990046-63990068 GTTCCTGTGATGGATATGTAGGG - Intergenic
1044173285 8:89083553-89083575 GGGGCTGAGATGCATCTTGAAGG - Intergenic
1044618479 8:94166306-94166328 GGTGCTGTGAAGGCACCGGAAGG - Intronic
1045655055 8:104377967-104377989 GGTACTGTGATGGATTGGGAGGG - Intronic
1045982839 8:108211759-108211781 GCTGCTGTGCTGTATCTTGAGGG - Intronic
1046828394 8:118717153-118717175 GATGATGTGATGGATGTGGATGG + Intergenic
1048223455 8:132564060-132564082 GGTGGTGTGTTGGATCTGAGGGG - Intergenic
1049081803 8:140449045-140449067 GGTGCTTTGCAGGGTCTGGAAGG - Intronic
1050751085 9:8938168-8938190 GATGCTGTGAAGTATGTGGATGG + Intronic
1052680051 9:31679625-31679647 CCTGCTGTGATGCATCAGGAAGG + Intergenic
1052866835 9:33469171-33469193 GGTGTTGAGGTGGAGCTGGAGGG - Intronic
1055150414 9:72991595-72991617 GGTGCTTTTATGAATCTAGAGGG + Intronic
1055942075 9:81659986-81660008 AGTGCTGTGGAGGATCTTGAAGG - Intronic
1056329485 9:85509999-85510021 ACTGCTGTGATGGATCTGGGAGG - Intergenic
1056577354 9:87866644-87866666 GGTGGTGTGCTGGCTTTGGAAGG + Intergenic
1057480874 9:95444761-95444783 GGTGCTGGTGTGGATTTGGATGG + Exonic
1058078308 9:100673143-100673165 GGAGTTTTGATGAATCTGGAAGG + Intergenic
1058918087 9:109586792-109586814 GGTCCTGGAAAGGATCTGGATGG + Intergenic
1059443381 9:114323465-114323487 GGTTCTGTGCTGGGCCTGGAGGG + Intronic
1059444570 9:114330236-114330258 GGTTCTGTGCTGGGCCTGGAGGG + Intronic
1185546539 X:950020-950042 GGTGCTGGGATGGTTTTGGAAGG + Intergenic
1186840903 X:13484052-13484074 GGGGCTGAGAGGGATCTAGAAGG + Intergenic
1187739924 X:22344652-22344674 GGAGCTGGCATGGTTCTGGATGG - Intergenic
1192178273 X:68899309-68899331 GGTTCTGTGAGGGATCAGGGAGG - Intergenic
1194458427 X:94134307-94134329 GTTGCTGTGGTGAACCTGGAAGG + Intergenic
1200209591 X:154341401-154341423 GGGGCTGGGATGGATCTCGCGGG + Intergenic
1200221285 X:154390727-154390749 GGGGCTGGGATGGATCTCGCGGG - Intronic
1201865795 Y:18652801-18652823 GGTACTTTGAAGGAGCTGGAAGG - Intergenic