ID: 1135992891

View in Genome Browser
Species Human (GRCh38)
Location 16:27228557-27228579
Sequence GGGTGCTGTGATGGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 1, 2: 4, 3: 23, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992891_1135992907 28 Left 1135992891 16:27228557-27228579 CCTCCAGATCCATCACAGCACCC 0: 2
1: 1
2: 4
3: 23
4: 237
Right 1135992907 16:27228608-27228630 CCTCCCCTCCAGATCCATCATGG 0: 4
1: 2
2: 17
3: 81
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992891 Original CRISPR GGGTGCTGTGATGGATCTGG AGG (reversed) Intronic
900833422 1:4981260-4981282 AGGTGCTGTGATTGCTCTGGTGG - Intergenic
900913566 1:5618989-5619011 GGGTGCTGTGTGGGGTCTTGAGG + Intergenic
902838410 1:19060637-19060659 GGGATCTGTGATGGAGTTGGGGG - Intergenic
904442542 1:30541026-30541048 GGCTGTTGTGATGGTGCTGGTGG + Intergenic
905955904 1:41995827-41995849 TGATGCTGTGATGGAGCTGAAGG - Intronic
906683214 1:47744962-47744984 GGGTGCTGTGCTAGATCCTGGGG - Intergenic
913150039 1:116032640-116032662 TAGTGCTGTGATGGTTCTGTGGG - Intronic
915056311 1:153134169-153134191 GGTGGCTGTGATGGCCCTGGTGG - Intergenic
915396618 1:155590031-155590053 GGGTGCAGTGTTGGAGGTGGGGG + Intergenic
917587123 1:176438499-176438521 GAGTGCTTTGATGTATCTTGTGG + Intergenic
918148689 1:181780248-181780270 GGTTGCTGTGAGGGATCTGAGGG + Intronic
920670862 1:208002854-208002876 GGGTGCTGTGATTGCGGTGGCGG + Intergenic
922765801 1:228156027-228156049 GCCTGCTGTGATGGGTCAGGTGG + Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
924384812 1:243490834-243490856 GGGTTCTGGGCTGGGTCTGGTGG - Intronic
1066153553 10:32650792-32650814 GGGTGCAGTGTGGGATCTGAAGG + Intronic
1069875345 10:71559627-71559649 GGGTGCTGAGTTGGCTCTGGAGG + Intronic
1070376674 10:75839000-75839022 TGGTGCTCTGAAGGATTTGGGGG + Intronic
1070492093 10:76986844-76986866 GGGCTCTGTAGTGGATCTGGGGG - Intronic
1073650815 10:105356047-105356069 GGGTTCAGTGATGCATCTTGCGG + Intergenic
1074836297 10:117299006-117299028 GAGGACTGTGATGGATATGGAGG - Intronic
1074921674 10:118020589-118020611 CGGTGCTGGGATGGGGCTGGGGG - Intronic
1075547031 10:123362845-123362867 GGGTGGTGTGCTGGACATGGGGG + Intergenic
1075634626 10:124022145-124022167 TGGTGCAGAGATGGACCTGGAGG - Intronic
1076200430 10:128553401-128553423 GGGTGCCGTGATGCAGCTGCTGG - Intergenic
1076532611 10:131154833-131154855 GCGTGCTGTGCTGGAACTGAAGG + Intronic
1077268912 11:1666056-1666078 GGCTGCTGTGGCGGCTCTGGAGG - Intergenic
1077271840 11:1685124-1685146 GGCTGCTGTGGCGGCTCTGGAGG + Intergenic
1077739458 11:4829321-4829343 AGGTGATGTGATGGAGTTGGGGG - Intronic
1082861262 11:57858679-57858701 GGGTGCAGTGTTGGCTCAGGCGG - Intergenic
1084444294 11:69194515-69194537 TGGTGCTGTGATGGTGGTGGTGG + Intergenic
1084942338 11:72619658-72619680 GGGTGCTGTGAATGCGCTGGTGG + Intronic
1086174783 11:83878127-83878149 GGGTGCTATTATGGATATGTAGG - Intronic
1086434599 11:86769154-86769176 GGGTGTAGTGATGGTTCTGCAGG - Intergenic
1087838213 11:102895940-102895962 GTGTTGTGTGAGGGATCTGGTGG + Intergenic
1087918533 11:103838286-103838308 GGCTGCATGGATGGATCTGGAGG + Intergenic
1090252006 11:125258135-125258157 GGGTGCTGGGGTGGGTGTGGCGG - Intronic
1090271150 11:125387252-125387274 AGGAGCTGGGATGGACCTGGGGG + Intronic
1091482214 12:844772-844794 GGGTGCTGAGATAAATGTGGAGG + Intronic
1096116738 12:49059685-49059707 GGCGGCTGTGATCGCTCTGGCGG - Intronic
1096319305 12:50597587-50597609 GTGTTGTCTGATGGATCTGGGGG + Intronic
1096847908 12:54418228-54418250 GGGTGCTGGGATGTGTCGGGAGG - Intronic
1098103113 12:67040190-67040212 GGGTAGTGTGAGGGATCTGCAGG - Intergenic
1098799882 12:74942240-74942262 GGGTGATGTGATATAACTGGTGG + Intergenic
1099726121 12:86430599-86430621 GAGTACTGTGATGGATTTTGAGG + Intronic
1100591581 12:96035169-96035191 GGGTGCTGTGAGAGATCTGGGGG + Intronic
1102026090 12:109714915-109714937 GGGTTCTGCGCTGGAGCTGGGGG + Intronic
1102574814 12:113849692-113849714 GGGTTCTGTGCTGGATCTTCAGG - Intronic
1103304531 12:119953472-119953494 GATTGCTGTGTTGGATCTGAAGG + Intergenic
1103917393 12:124383077-124383099 GAGAGCTGTGATGGTGCTGGTGG - Intronic
1104896872 12:132168979-132169001 GAGTGCACTGAGGGATCTGGGGG + Intergenic
1104897956 12:132173463-132173485 GGCTGCTGGGATGGATTTTGGGG + Intergenic
1105003583 12:132707051-132707073 GGATGCCGTGAAGGATGTGGCGG + Intergenic
1105587179 13:21756236-21756258 GGGGGCTGTGGTGGGTCTGTTGG + Intergenic
1106358170 13:29004770-29004792 GGGTGTTATGAAGGATATGGAGG + Intronic
1112418761 13:99228241-99228263 GGGTGTTGTGATGGTGCTGGTGG + Intronic
1112805248 13:103157769-103157791 AGGTGCTGTGATTTATGTGGTGG - Intergenic
1113015608 13:105824896-105824918 TGGTGCTGTGATGGATTTACTGG + Intergenic
1113316568 13:109186359-109186381 GGGTGCTGTGGTGCCTCAGGGGG + Intronic
1113593981 13:111518421-111518443 GAGTGTGGTGATGGATTTGGAGG + Intergenic
1115601420 14:34959303-34959325 GAGAGCTGTGATAGATCAGGAGG - Intergenic
1115885652 14:37968950-37968972 GGGTGGGGTGAGGGAACTGGTGG + Intronic
1116714042 14:48406236-48406258 GGGTTGTGGGAGGGATCTGGTGG - Intergenic
1120194251 14:81465610-81465632 GGGCACTGTGACGGAGCTGGGGG - Intergenic
1120517190 14:85484822-85484844 GGATGTTGGGATGGATGTGGTGG - Intergenic
1120526110 14:85578972-85578994 GGGTGCTGGGGTGGATCAGAAGG - Intronic
1120607526 14:86597541-86597563 TGGGGCTGTGATGGTGCTGGGGG + Intergenic
1121042627 14:90761372-90761394 TGGCCCTGTGGTGGATCTGGTGG - Intronic
1122128900 14:99593789-99593811 GGAGGCTGTGAAGGCTCTGGAGG - Intronic
1122298995 14:100721433-100721455 GGGTGCAATGATGGATTTGAAGG - Intergenic
1122397295 14:101442393-101442415 GGGTGATGAGAGGAATCTGGGGG - Intergenic
1122575593 14:102739591-102739613 GGGTGCTGGGATGGGCCAGGAGG + Intergenic
1122599456 14:102914035-102914057 GGCTGCTGGGCTGGATCAGGCGG + Intergenic
1127015956 15:54688337-54688359 GAGTTCTGAGATGGAGCTGGAGG + Intergenic
1127024717 15:54791531-54791553 GTGTGCTGGGAGGGATCTGGTGG + Intergenic
1127597524 15:60501297-60501319 TGGTGATGTGATGGAAGTGGTGG - Intronic
1128103799 15:65028597-65028619 GGCTGCTGTGAAGTATCTGTAGG + Intronic
1128664274 15:69526883-69526905 GGGCACTGTGATGGGCCTGGGGG + Intergenic
1128775971 15:70320887-70320909 TAGTGCTGTGATGAATTTGGGGG + Intergenic
1130212576 15:81938653-81938675 GGGCTCTGTGAGGGAGCTGGAGG - Intergenic
1131610589 15:93957234-93957256 GAGTCCTGTGATGGATGTGTTGG - Intergenic
1132493220 16:246060-246082 GGGTGCGGTGGTGGGTGTGGTGG + Intronic
1133031850 16:3014786-3014808 GGGTGCAGTGTTGGAGGTGGGGG + Exonic
1134866022 16:17607882-17607904 GGGTGATGAGCTGGATGTGGCGG - Intergenic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1137077056 16:35981062-35981084 GAGTGCTTTGATGCATTTGGTGG + Intergenic
1138247348 16:55477752-55477774 GGGTGAGGGGATGGAGCTGGAGG - Intronic
1138432577 16:56978342-56978364 AGGTGGTGAGAAGGATCTGGAGG - Intronic
1139163765 16:64541370-64541392 GGGTGGTGAGATTGTTCTGGAGG - Intergenic
1139305217 16:65980052-65980074 TGGTGCTGAGATGGAGTTGGGGG - Intergenic
1139429900 16:66905456-66905478 GGGTTCTGGGCTGGAGCTGGAGG - Intergenic
1141017231 16:80461892-80461914 GGGTGCAGAGATGGGTCAGGTGG - Intergenic
1143545579 17:7593223-7593245 GGGGGATGTGATGGATCCTGAGG - Intronic
1143670342 17:8392286-8392308 GGGTGCTGTGGTGGAGGTCGGGG + Exonic
1144331154 17:14225150-14225172 GGGTGCAGTAATGAATATGGAGG + Intergenic
1144573062 17:16412415-16412437 GGATGTGGTGATGGCTCTGGAGG + Intergenic
1144761856 17:17711512-17711534 GGAGGCTGGGATGGAGCTGGAGG + Intronic
1144771701 17:17763127-17763149 GGATGCAGGGAAGGATCTGGGGG - Intronic
1144809111 17:17987308-17987330 GACAGCTGTGATGGAGCTGGAGG + Intronic
1144823216 17:18089843-18089865 GGGTGCAGTGATGGGACAGGAGG + Intronic
1145778418 17:27545555-27545577 GGGTGCTGTGCTGGCTCCTGAGG + Intronic
1147359220 17:39920853-39920875 GGGGGCTGTGAGGGAACTGGCGG - Intergenic
1147428008 17:40355472-40355494 GGGTGCTGGCTTGGATGTGGGGG - Intronic
1148153025 17:45407387-45407409 GGGTGCTGGGCTGAATGTGGGGG - Intronic
1148230028 17:45926693-45926715 GTGTGGTGTGATGGTTCTGGAGG + Intronic
1148526356 17:48340217-48340239 GGGTGCTGTCATAGATTTAGAGG + Intronic
1149451976 17:56756939-56756961 GAGTGCTATTATGTATCTGGAGG + Intergenic
1149517201 17:57289685-57289707 GGGAGCTGTGATGGATTTTATGG - Intronic
1151784872 17:76270520-76270542 GGGCGCTGGGCTGGAGCTGGGGG + Exonic
1151948515 17:77332675-77332697 GGGGACTGTGATGCACCTGGAGG - Intronic
1152309035 17:79537970-79537992 GGGTGCTGTGGTGGGGTTGGGGG + Intergenic
1152466921 17:80471711-80471733 AGGTACTGTGCTGGATGTGGTGG - Exonic
1152605338 17:81286732-81286754 GGCTCCTGTGCTGGCTCTGGGGG - Intronic
1152778821 17:82217528-82217550 AGGTGCTTTGAGGGAGCTGGGGG + Intergenic
1153658119 18:7303436-7303458 AGGTGGTGTGATGCAACTGGAGG - Intergenic
1157152572 18:45232904-45232926 CGGTGCTGTGTTGGTTCAGGTGG + Intronic
1159293502 18:66452005-66452027 GGGTTCTGTGATTAATCTGTGGG + Intergenic
1160076476 18:75681936-75681958 GGGGGCTGTGAAGGATCCGTGGG - Intergenic
1160957683 19:1701265-1701287 GGGTTCTGTGATGGAGAGGGGGG - Intergenic
1161072535 19:2269959-2269981 GGGTGCGGAGTTGGATTTGGGGG + Intronic
1162158642 19:8696479-8696501 GGTCTCTGTGATGGATCTGGGGG + Intergenic
1162183984 19:8890438-8890460 TGGTGATGTGATGGTTCTGATGG - Intronic
1163748957 19:19064125-19064147 GGGTCCTGTCATGGATCCCGGGG + Intronic
1163753717 19:19093995-19094017 AGATGGGGTGATGGATCTGGGGG + Intronic
1164466516 19:28491590-28491612 GAGTGGTGGGATGGATGTGGAGG - Intergenic
1166817673 19:45556705-45556727 GGGAGCTCTGCTGGAGCTGGAGG + Intronic
1166897670 19:46034052-46034074 GGCTGCAGTGCTGAATCTGGGGG - Intergenic
1166996738 19:46723064-46723086 TGGAGCTGTGCGGGATCTGGAGG - Intronic
1167206093 19:48103415-48103437 GGGTTCTGAGCTGGATGTGGAGG - Intronic
1167718279 19:51158576-51158598 TGGTGGTGTGATGCATTTGGGGG - Intergenic
925498240 2:4476610-4476632 GTGTTGTGTGAGGGATCTGGTGG + Intergenic
927370558 2:22349998-22350020 GTGTGGTGTGGTGGATTTGGGGG + Intergenic
928359059 2:30648283-30648305 GGGAGCTTTTATGGCTCTGGAGG - Intergenic
928400631 2:30976162-30976184 GAGAGCTGAGATGGATCTGCTGG - Intronic
932542626 2:72672044-72672066 GGGTGCTGGCAAGGATATGGAGG + Intronic
932576231 2:72963786-72963808 GGTTCCTGTGCTGGATCAGGAGG - Intronic
935065535 2:99644037-99644059 GGGTGCTGTGCTGGGGCTGGGGG - Intronic
936008873 2:108912083-108912105 GGGTGCTCTGAGGGCTCTGGAGG + Intronic
937907565 2:127059627-127059649 GGGTGCTGTGATGGACAGGCAGG - Intronic
943955681 2:194186410-194186432 GGGTGCATGGATGGAACTGGAGG - Intergenic
945920866 2:215753438-215753460 ACGTGCTGTGATGGATATGCTGG - Intergenic
946302911 2:218835258-218835280 GTGTCCTGTGATGGATATGAAGG - Intergenic
947931830 2:233971223-233971245 GTGTGCTATGATAGATCTGGAGG + Intronic
948507129 2:238435819-238435841 GGGGGCCGAGGTGGATCTGGTGG + Exonic
949031705 2:241800176-241800198 GGGTGCAGTGATGGGTCTGGTGG + Intronic
1169907286 20:10616755-10616777 GGGTGCTATGTTAGATATGGTGG - Intronic
1172008620 20:31833770-31833792 GGGGGCACTGATGGCTCTGGGGG + Exonic
1173001891 20:39110760-39110782 GGGAGCTTTGCTGGGTCTGGAGG + Intergenic
1173586460 20:44186802-44186824 GGGTGCAGTGGTGAGTCTGGGGG - Exonic
1173869441 20:46332327-46332349 GGGAGCGGTGGTGGATCTGGGGG + Intergenic
1175194440 20:57233238-57233260 GGGTGCTGGGATGTAACTGGAGG - Intronic
1175497178 20:59423230-59423252 GGCAGCTGTGACGGGTCTGGGGG - Intergenic
1175569114 20:60005878-60005900 GGGTGCTGGGATGGTTAGGGAGG - Intronic
1175624482 20:60479015-60479037 GGGTGCTGGGATGCATGTGGAGG - Intergenic
1175844863 20:62052901-62052923 GGGTGGTGTGAGGGACCTGATGG - Intronic
1178396292 21:32246544-32246566 GGGTGCTTGGATGAATCTTGGGG - Intergenic
1179587569 21:42383397-42383419 GGGTGCTGTGGAGGATGCGGTGG + Intronic
1179804928 21:43831385-43831407 GGGTCCTGTGGAGGATCTGGGGG + Intergenic
1179826343 21:43968387-43968409 GGGTCCTGGGGAGGATCTGGGGG + Intronic
1180745158 22:18083467-18083489 TGGAGCTGTGCTGGATGTGGTGG + Exonic
1180959202 22:19755084-19755106 GGGTGCTGAGTTAGAACTGGGGG - Intergenic
1182346435 22:29669287-29669309 GGGTGATGGGATGGATTTGTTGG + Intronic
1182900590 22:33895069-33895091 GGGTGCTGTGGGGGATGGGGAGG + Intronic
1184037946 22:41927291-41927313 GGGTGCTGGGAGGTGTCTGGGGG + Intergenic
1184483053 22:44759320-44759342 GAGGGCTGTGATGGACCTGGGGG + Intronic
1184616057 22:45639582-45639604 GGGTGCTGTGAGGGGATTGGTGG - Intergenic
1184744743 22:46449739-46449761 GGGTGCTGGCATGGAGGTGGAGG + Intronic
950525746 3:13522104-13522126 GTGTGGTGGGAGGGATCTGGTGG - Intergenic
950575581 3:13830257-13830279 GGGAGCTTTGCTGGATGTGGAGG + Intronic
951918116 3:27823082-27823104 TGATGATGTCATGGATCTGGTGG + Intergenic
952557863 3:34553876-34553898 GGGTGTGGTGATGGAGGTGGGGG - Intergenic
953252606 3:41260483-41260505 GGATGCTGTGAGGCAGCTGGAGG - Intronic
954396627 3:50296679-50296701 GGGGGCCCTGATGGAACTGGGGG + Exonic
954983770 3:54771057-54771079 GGTTGATGTGGTGGATCTGGGGG + Intronic
957404584 3:79760842-79760864 GGGTACTGTTATGGGTTTGGGGG + Intronic
959016322 3:101138341-101138363 GGATTCTTTGATGGATCTTGTGG - Intergenic
961018949 3:123487972-123487994 TGGTGCTGTGATCAATCTGCTGG - Intergenic
962895463 3:139709919-139709941 AGGTGATGTCATGGATTTGGGGG + Intergenic
963901774 3:150740046-150740068 GGGTGCCGTGAGGGCCCTGGAGG + Intergenic
965931949 3:174055066-174055088 AGGTGCTGTGATATATGTGGAGG - Intronic
969262721 4:6043824-6043846 GGGTGCTGGGATGTCTTTGGAGG - Intronic
981937356 4:150251183-150251205 GGGTGGTGTGGGGGATTTGGGGG - Intronic
983334969 4:166379395-166379417 TGGTGCTGGAGTGGATCTGGAGG + Intergenic
983824989 4:172248661-172248683 GGGTCCTGAGAGGGATCCGGTGG + Intronic
984765517 4:183397922-183397944 GGCCGCTGTGAAGGCTCTGGAGG + Intergenic
986132195 5:4942217-4942239 GGGTGCTGCGATGGGACTTGGGG - Intergenic
986486705 5:8245234-8245256 GGGTCCTGAGTTGGATTTGGAGG + Intergenic
987373901 5:17217435-17217457 GGGTGGGGAGATGGAGCTGGAGG + Intronic
989862722 5:46401091-46401113 GAGTGCTTTGATGGCTGTGGTGG + Intergenic
992381111 5:76238771-76238793 GGGTTCTGAGAAGGATGTGGAGG + Intronic
992746862 5:79829102-79829124 TGGTACTGTGTTGGATCTGGTGG - Intergenic
994744458 5:103661772-103661794 GTGTGCTGTGCTGGATCTGAGGG + Intergenic
995065491 5:107857392-107857414 TGTTGATGTGATTGATCTGGGGG + Intergenic
997111731 5:131082548-131082570 GGGGGCTGTGAGAGAACTGGAGG + Intergenic
997510074 5:134448005-134448027 GGGTGCTTTGGTGGCGCTGGGGG - Intergenic
999491010 5:152051959-152051981 GGCTGCTGTTGTGGATCGGGAGG + Intergenic
1001687913 5:173609246-173609268 GTGTCCTGAGATGGAGCTGGAGG + Exonic
1001758734 5:174190423-174190445 GGGGGCTGTGATGAGTTTGGAGG - Intronic
1004755182 6:18602726-18602748 GGGTGCTGTGCTGAATCAAGTGG - Intergenic
1006566286 6:34960540-34960562 GGGCACTGTGCTGGATTTGGAGG - Intronic
1009025731 6:57998362-57998384 GGGAGCAGTGATGGAGGTGGTGG - Intergenic
1011161807 6:84399579-84399601 GGGTGAAGTGATGGAGGTGGAGG - Intergenic
1013607604 6:111764929-111764951 GGGTGCTCTGATGGAACCGCTGG + Intronic
1013643938 6:112116952-112116974 GGGTGTTCTGCTGGATATGGTGG + Intronic
1015342767 6:132120941-132120963 AGGATCTGTGATGAATCTGGAGG - Intergenic
1017491962 6:154952774-154952796 GGGTGATGTGGTGGGTGTGGTGG - Intronic
1019226801 6:170518455-170518477 GGGTGCTCTGTAGGATCTGTAGG - Intergenic
1020059696 7:5143253-5143275 GTGTGATGTGATGGAGTTGGCGG - Intergenic
1020799437 7:12715855-12715877 GAGTGCTCTGCAGGATCTGGAGG + Intergenic
1024100380 7:46026720-46026742 GGGTGCTGGGATAGGGCTGGTGG + Intergenic
1024272831 7:47655385-47655407 GGATGCTGGGAGGGATGTGGGGG + Intronic
1025282699 7:57639671-57639693 GGGTGCAGGCATGGAACTGGAGG - Intergenic
1025302018 7:57825746-57825768 GGGTGCAGGCATGGAACTGGAGG + Intergenic
1027972758 7:85106916-85106938 GTGTCCTGTGAGGGATCTGGTGG - Intronic
1029251435 7:99239530-99239552 GGGTGGTGTGCTGGATGTGATGG + Intergenic
1029406074 7:100374655-100374677 GGGGGCGGGGCTGGATCTGGAGG - Intronic
1031954596 7:127929494-127929516 GGGTGCAGTGCTGGGTCTGCAGG - Intronic
1033513534 7:142083930-142083952 GGGTGGTGTGAAGAATATGGTGG + Intronic
1034418333 7:150976735-150976757 GGAGGCTGGGATGGATGTGGGGG - Intronic
1035596695 8:863901-863923 GGGTGCCGCAATGGACCTGGGGG - Intergenic
1035643669 8:1202182-1202204 GTGTGGTGTGATGTATCTGTTGG + Intergenic
1036627994 8:10487833-10487855 GACAGCTATGATGGATCTGGAGG - Intergenic
1041047457 8:53900978-53901000 GGATGCTGTGAGGGGTGTGGAGG - Intronic
1041640700 8:60197629-60197651 GGGGGTTGTGATGGATATGGAGG - Intronic
1041946687 8:63451849-63451871 GAGTGAGGTGATGGATTTGGGGG - Intergenic
1042040452 8:64583479-64583501 GGGAGCTGTGATGGATCTGTTGG + Exonic
1042964256 8:74334249-74334271 GGGTGCAGGGATGGATGGGGAGG - Intronic
1045655056 8:104377968-104377990 AGGTACTGTGATGGATTGGGAGG - Intronic
1045982840 8:108211760-108211782 GGCTGCTGTGCTGTATCTTGAGG - Intronic
1048181820 8:132202117-132202139 GGGTGCTGTGCTGGACTTTGGGG + Intronic
1048223456 8:132564061-132564083 TGGTGGTGTGTTGGATCTGAGGG - Intergenic
1048982767 8:139711941-139711963 GGGTGCTGTGCTGGATGCCGGGG - Intergenic
1049264686 8:141661110-141661132 GGGGGCTGTGGGGGACCTGGGGG + Intergenic
1049325043 8:142017326-142017348 GTGTGCTGTCCTGGCTCTGGTGG - Intergenic
1051082681 9:13311298-13311320 GGGTTCTGGGAAGGACCTGGGGG + Intergenic
1053223547 9:36331745-36331767 GTTTTCTGTGATGGCTCTGGGGG - Intergenic
1056736532 9:89214754-89214776 GGGCGCTCCGCTGGATCTGGTGG + Intergenic
1056944952 9:90986508-90986530 GGGTGCTTCGATGGACCTAGCGG - Intergenic
1057843652 9:98505731-98505753 GGGTGGAGTGATGCATCTGCCGG + Intronic
1057988684 9:99744661-99744683 GGGTGGTGGGATGGGGCTGGGGG - Intergenic
1058591765 9:106572823-106572845 TGTTGCTGTGCTGGATCTTGAGG - Intergenic
1059706310 9:116826532-116826554 GGGAGCTGTGATGGGTTGGGCGG - Intronic
1060448690 9:123716441-123716463 GGCAGCTGTGATGGCTCTGCAGG - Intronic
1060630247 9:125151258-125151280 GGGAGATGTGAAGGATCTGGTGG + Intronic
1062615083 9:137392685-137392707 GGGTGCTGTGTCTGTTCTGGGGG + Intronic
1186606354 X:11096980-11097002 AGGTGCTGTGTTGGGTATGGTGG - Intergenic
1188368190 X:29335609-29335631 GTATTCTGTCATGGATCTGGAGG + Intronic
1189245313 X:39558762-39558784 GGATTCTGTTATGGTTCTGGAGG - Intergenic
1191171360 X:57450330-57450352 AGTTGCTGTGAGGGATTTGGGGG - Intronic
1192269066 X:69561520-69561542 GTAGGCTGTGATGGACCTGGGGG + Intergenic
1192447677 X:71223025-71223047 GGGTGCGGCGATGGACCGGGCGG + Intronic
1193458137 X:81755693-81755715 GGCTGCTGTGATTTTTCTGGGGG - Intergenic
1195693116 X:107645270-107645292 GGGAGATGTGAAGGATCGGGTGG + Exonic
1196055878 X:111354582-111354604 GGGAGGTGGGATGGATTTGGAGG - Intronic
1196829266 X:119763501-119763523 CAGGGCTGTGATGGATCAGGGGG + Intergenic
1197992674 X:132334849-132334871 GGAAGCTATGATGTATCTGGGGG - Intergenic
1198451195 X:136768063-136768085 GGGTTCTGAGTTGCATCTGGGGG - Intronic
1198871243 X:141178769-141178791 GGGTGCTCTGATAGGTCCGGTGG - Intergenic
1200209590 X:154341400-154341422 AGGGGCTGGGATGGATCTCGCGG + Intergenic
1200221286 X:154390728-154390750 AGGGGCTGGGATGGATCTCGCGG - Intronic