ID: 1135992910

View in Genome Browser
Species Human (GRCh38)
Location 16:27228613-27228635
Sequence GGGTACCATGATGGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 3, 2: 2, 3: 12, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992910 Original CRISPR GGGTACCATGATGGATCTGG AGG (reversed) Intronic
900295325 1:1946395-1946417 GGGCACCTTGATGGAGCTGAAGG + Exonic
901123533 1:6913431-6913453 CGTTACCATGATGGCTCTGCTGG - Intronic
902958051 1:19940219-19940241 GGGTATCATGATGTATCTTCTGG - Intergenic
903464541 1:23542989-23543011 GGGTACTATGCTGGATATTGGGG - Intergenic
905210830 1:36373035-36373057 GGATAGCAAGATGGATTTGGGGG + Intronic
912692262 1:111813187-111813209 GGGTTCCAAGAGTGATCTGGGGG - Intronic
914220722 1:145679564-145679586 GTGCACCAAGATGGATCTGAAGG - Intronic
920985306 1:210883364-210883386 AGGGACCAGAATGGATCTGGGGG + Intronic
921439412 1:215166721-215166743 GGGAACCATGATTTTTCTGGTGG - Intronic
921719679 1:218456597-218456619 GTGTCCCATGATGGGACTGGTGG + Intergenic
922045903 1:221946077-221946099 AGGTACCATGATGGCAATGGGGG - Intergenic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
922995216 1:229951912-229951934 GGCCCCCATGATGGAACTGGAGG + Intergenic
1063345916 10:5312372-5312394 GGCTCCCATGATGGGCCTGGTGG - Intergenic
1063714706 10:8515114-8515136 GGTCACCCTGATGGATATGGTGG + Intergenic
1065918469 10:30371064-30371086 TGCTACCCTGAAGGATCTGGAGG - Intronic
1066659842 10:37728457-37728479 GGGGACCATGGTGGGTATGGGGG - Intergenic
1066957532 10:42187216-42187238 CGGTACCAGGATGGTTCTGCAGG + Intergenic
1067533261 10:47089865-47089887 GGGTTCCATCATGGATCAAGGGG + Intergenic
1068927636 10:62556654-62556676 GGGTATAATCCTGGATCTGGGGG - Intronic
1071837711 10:89435901-89435923 TGGGACCATGATGGTTTTGGGGG + Intronic
1074541087 10:114365650-114365672 AGTTACCATGATGGATCTAAGGG + Intronic
1079492620 11:21006249-21006271 GGATCCCATGATGGGACTGGTGG + Intronic
1080150270 11:29044579-29044601 GGGAACCAGGATGGAGCTGGAGG + Intergenic
1080375517 11:31705300-31705322 GGGCCCCATGATGGGACTGGTGG - Intronic
1080723594 11:34872857-34872879 GGTTACCAAGATGGATGTCGGGG - Intronic
1086022403 11:82247281-82247303 GGGTACCATCCTGGAACTGGGGG - Intergenic
1088149168 11:106723491-106723513 GTGTACCAGGAAGGTTCTGGTGG - Intronic
1089781650 11:120877298-120877320 AGGTACCATGCTGGGCCTGGGGG + Intronic
1091027021 11:132150459-132150481 GGTTACCATTATGGATCAGCAGG + Intronic
1091812571 12:3411709-3411731 GGGCCCCATGATGAAACTGGTGG + Intronic
1094092235 12:26663037-26663059 GGGAACCCAGATGGATCTAGGGG - Intronic
1095563696 12:43595487-43595509 GGGCACCGTGATGGATCAGAAGG + Intergenic
1096579013 12:52572469-52572491 GAGAAGCATGAGGGATCTGGTGG - Exonic
1097233473 12:57525663-57525685 GGGCACCAGGCTGGATCTGAGGG - Exonic
1097376736 12:58852176-58852198 GGACACCCTGCTGGATCTGGAGG + Intergenic
1097377744 12:58859305-58859327 GGACACCCTGCTGGATCTGGAGG + Intergenic
1100682427 12:96941807-96941829 TGGAACCATAATGAATCTGGAGG - Intronic
1100890033 12:99115317-99115339 TGGGAACATGATGGAGCTGGAGG + Intronic
1103468715 12:121162791-121162813 GGGTACCCTGGAAGATCTGGGGG - Intronic
1105336637 13:19477061-19477083 GGGAACATGGATGGATCTGGAGG + Intronic
1106315511 13:28589966-28589988 ACGTACAATGATGGATCTGATGG + Intergenic
1108949937 13:56079094-56079116 GGATAACATGATGTTTCTGGGGG + Intergenic
1114202761 14:20538441-20538463 GGGTACATGGATGGAGCTGGAGG - Intergenic
1114962735 14:27914462-27914484 GGGTACCATGCTGGAGGTAGAGG - Intergenic
1115151671 14:30293315-30293337 GGACACCCTGCTGGATCTGGAGG - Intergenic
1115656003 14:35444413-35444435 GGCCACCATGATGGAACTGGTGG - Intergenic
1116740337 14:48746751-48746773 GGACACCCTGCTGGATCTGGAGG - Intergenic
1121676223 14:95755065-95755087 AGGTGCCATGATGGAGGTGGTGG + Intergenic
1121860076 14:97309091-97309113 AGGGACCATGCTGGATGTGGTGG - Intergenic
1122298995 14:100721433-100721455 GGGTGCAATGATGGATTTGAAGG - Intergenic
1123125470 14:105942917-105942939 GGATACCCTGATGGATCCGGAGG - Intergenic
1123472372 15:20564963-20564985 TGCTACCCTGAAGGATCTGGAGG + Intergenic
1123645631 15:22435390-22435412 TGCTACCCTGAAGGATCTGGAGG - Intergenic
1123732677 15:23159954-23159976 TGCTACCCTGAAGGATCTGGAGG + Intergenic
1123750810 15:23357334-23357356 TGCTACCCTGAAGGATCTGGAGG + Exonic
1124283181 15:28381250-28381272 TGCTACCCTGAAGGATCTGGAGG + Exonic
1124299518 15:28530363-28530385 TGCTACCCTGAAGGATCTGGAGG - Exonic
1124563273 15:30794345-30794367 TGCTACCCTGAAGGATCTGGAGG + Intergenic
1124960013 15:34386888-34386910 TGCTACCCTGAAGGATCTGGAGG - Intronic
1124976642 15:34533109-34533131 TGCTACCCTGAAGGATCTGGAGG - Intronic
1125471274 15:40006497-40006519 TGATACCATGTTGGATCTGTTGG + Intronic
1128864807 15:71106418-71106440 GGGTACCATGGCAGATCTGTTGG + Intronic
1129040271 15:72679963-72679985 GGTTACCAGGATGCTTCTGGCGG - Intronic
1129474999 15:75779188-75779210 TGTTACCCTGAAGGATCTGGAGG + Intergenic
1129838777 15:78730782-78730804 TGTTACCCTGAAGGATCTGGAGG + Intergenic
1129901484 15:79154480-79154502 AGGTACCATGCTAGACCTGGAGG + Intergenic
1130440086 15:83944726-83944748 GGGTACCAGCATGGGTCTGTTGG - Intronic
1132433603 15:101779363-101779385 TGCTACCCTGAAGGATCTGGAGG - Intergenic
1134051628 16:11141499-11141521 GGGGACCGTGGGGGATCTGGAGG + Intronic
1134360849 16:13529863-13529885 AGGTAACCTGATTGATCTGGAGG + Intergenic
1135108136 16:19668995-19669017 GCAAACCATGATGGAGCTGGAGG - Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1139209524 16:65063803-65063825 GGGTACCAGGGTGGATTTGATGG + Intronic
1139661394 16:68423414-68423436 GGGATCCATGATGGGGCTGGCGG + Intronic
1142161852 16:88561898-88561920 GGGGGCCATGATGGAAGTGGGGG + Intergenic
1142755510 17:2014228-2014250 GAGCAGCATGAGGGATCTGGAGG + Intronic
1149243100 17:54673723-54673745 GGACACCCTGCTGGATCTGGAGG + Intergenic
1151224456 17:72638400-72638422 GGACACCCTGCTGGATCTGGAGG - Intergenic
1153617634 18:6949157-6949179 TGGAACCATGCTGGATGTGGAGG - Exonic
1155295830 18:24383912-24383934 AGGTACCATGATGGATAAGATGG + Intronic
1159093494 18:63875214-63875236 GGGGACATTGATGGAGCTGGAGG - Intronic
1159279769 18:66270425-66270447 GGACACCCTGTTGGATCTGGAGG + Intergenic
1159369441 18:67512724-67512746 TGGTGCCATGATGGATGTGTGGG - Exonic
1159972547 18:74671656-74671678 GGGTACATGGATGGAGCTGGAGG - Intronic
1160102760 18:75938491-75938513 GGACACCCTGTTGGATCTGGAGG + Intergenic
1160869640 19:1271392-1271414 GGGTACCGTGGTGGCTCTGCCGG + Exonic
1164056880 19:21629525-21629547 GGACACCTTGCTGGATCTGGAGG - Intergenic
1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG + Intergenic
1166669454 19:44701255-44701277 GGGTACCAGGGTGGGTGTGGCGG - Intronic
927955025 2:27201936-27201958 GTGTAGCAGGATGGACCTGGGGG - Intronic
932218702 2:69983819-69983841 CAGTACCATGATGGAACTGGGGG - Intergenic
934672423 2:96223131-96223153 GGACACCCTGCTGGATCTGGAGG + Intergenic
934977176 2:98811114-98811136 GGGAAACACGATGAATCTGGTGG + Intronic
935539601 2:104334035-104334057 GGCTTCCATGATGGGACTGGTGG + Intergenic
936445605 2:112592263-112592285 GGCCACCATGATGGGACTGGTGG + Intergenic
939107078 2:137961855-137961877 GGGGACAAGGATGGAACTGGAGG + Intergenic
939484450 2:142792630-142792652 GGGGACGTGGATGGATCTGGAGG + Intergenic
940859716 2:158759172-158759194 GGCCCCCATGATGGACCTGGTGG + Intergenic
942580683 2:177412959-177412981 GGACACCCTGCTGGATCTGGAGG + Intronic
943019265 2:182552952-182552974 GGACACCCTGCTGGATCTGGAGG - Intergenic
943787566 2:191895467-191895489 GCACACCATGGTGGATCTGGGGG + Intergenic
944360818 2:198854124-198854146 CAGTAACATGATGGAGCTGGAGG + Intergenic
947659140 2:231853828-231853850 GGGTAGCATGAGGGATCTTTGGG - Intergenic
947931830 2:233971223-233971245 GTGTGCTATGATAGATCTGGAGG + Intronic
949031705 2:241800176-241800198 GGGTGCAGTGATGGGTCTGGTGG + Intronic
1171386668 20:24774125-24774147 GCCTACCAAGATGGATCTGCAGG - Intergenic
1171851431 20:30311295-30311317 GGGTAACAGGAAGGATCGGGCGG + Intergenic
1172483921 20:35287401-35287423 GGGCACCCCGATGGAACTGGAGG + Exonic
1175698817 20:61122895-61122917 GGCCACCTTGGTGGATCTGGGGG + Intergenic
1176000266 20:62828492-62828514 GGGCACCATGATGTGCCTGGTGG + Intronic
951016247 3:17735759-17735781 GGACACCCTGCTGGATCTGGAGG + Intronic
953149937 3:40315589-40315611 GGATACCATCATGGGTCAGGTGG + Intergenic
954396627 3:50296679-50296701 GGGGGCCCTGATGGAACTGGGGG + Exonic
957129321 3:76203155-76203177 GGGTAGCAGTGTGGATCTGGGGG - Intronic
961081700 3:124033503-124033525 GGGTACCATGGGGGAGCTGGCGG + Intergenic
961302363 3:125930443-125930465 TGGGACCATGTGGGATCTGGCGG - Intronic
962048554 3:131787536-131787558 GCAGACCCTGATGGATCTGGCGG + Intronic
964749037 3:160037998-160038020 GGGCTCCAGGGTGGATCTGGAGG - Intergenic
964776908 3:160289156-160289178 GGGAACGTTGATGGAGCTGGAGG + Intronic
965742252 3:171887810-171887832 GGGAACATAGATGGATCTGGAGG - Intronic
968394145 4:217718-217740 TGGTACTATAATGGATCTAGGGG + Intergenic
969162626 4:5274846-5274868 GGACACCCTGCTGGATCTGGAGG - Intronic
969290464 4:6235771-6235793 GGTTACGATGATGGGTTTGGGGG + Intergenic
969645667 4:8427453-8427475 GGACACCCTGCTGGATCTGGAGG - Intronic
970705409 4:18795596-18795618 GGCTCCCATGATGGGACTGGTGG - Intergenic
970882069 4:20944238-20944260 GGCCACCATGAGTGATCTGGAGG + Intronic
973149701 4:46872170-46872192 GGGAACAAGGATGGAGCTGGAGG + Intronic
974462582 4:62206846-62206868 GGCTTGCATGATGGATTTGGGGG + Intergenic
974520771 4:62977429-62977451 GGACACCCTGCTGGATCTGGAGG - Intergenic
977342097 4:95771786-95771808 GGACACCCTGCTGGATCTGGAGG - Intergenic
977938753 4:102835010-102835032 GGATACCCTGATGGCTCTGTGGG + Intronic
980871961 4:138622087-138622109 GGACACCCTGCTGGATCTGGAGG + Intergenic
984037667 4:174690802-174690824 GGGAACATTGATGGAGCTGGAGG - Intronic
987443126 5:17982422-17982444 GGGAACATTGATGGAGCTGGAGG + Intergenic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
992746862 5:79829102-79829124 TGGTACTGTGTTGGATCTGGTGG - Intergenic
993642087 5:90417636-90417658 GGACACCCTGCTGGATCTGGAGG + Intergenic
993833684 5:92789972-92789994 GGGAACGTTGATGGAGCTGGAGG - Intergenic
995125586 5:108574438-108574460 GGACACCCTGCTGGATCTGGAGG + Intergenic
995976512 5:118042900-118042922 GCCTACAATGATGGAACTGGAGG + Intergenic
997248445 5:132370619-132370641 GGGTACCAGGAAGGTCCTGGCGG + Intronic
997750830 5:136344120-136344142 CGGCAACATGATGGAGCTGGAGG + Intronic
998644324 5:144045585-144045607 GGACACCCTGCTGGATCTGGAGG - Intergenic
999602002 5:153277227-153277249 GTGTGCCATGCTGTATCTGGTGG + Intergenic
1001422815 5:171600223-171600245 GGGTCCCATGATGGATGGGCAGG - Intergenic
1005315285 6:24598007-24598029 GGTCACCTTGATGGATATGGTGG - Intronic
1008492923 6:52104556-52104578 GGATTCCATTATGGTTCTGGAGG - Intergenic
1012204439 6:96442957-96442979 GGGTTCCAGGATGGTACTGGGGG - Intergenic
1013366628 6:109442203-109442225 AGTCACCATGATGGATCTGCAGG - Exonic
1015439829 6:133234936-133234958 GGCTCCCATGATGGAACTAGTGG - Intergenic
1015522291 6:134143796-134143818 GGGTCCCATGATGGGACTGATGG + Intergenic
1019917536 7:4143442-4143464 GGGTGCCAGGAGGGCTCTGGGGG - Intronic
1021289478 7:18825015-18825037 TGGTACCATGATTGATCCAGTGG - Intronic
1022117663 7:27276517-27276539 GGACACCCTGCTGGATCTGGAGG - Intergenic
1022451875 7:30523406-30523428 TGCTACCCTGAAGGATCTGGAGG - Intronic
1023863103 7:44227091-44227113 GGGGACCAAGGTGGATGTGGGGG + Intronic
1024059152 7:45685482-45685504 GAGTAACAAGATGGAGCTGGAGG + Intronic
1025126198 7:56347059-56347081 GGGTTCCAGGATAGATATGGTGG + Intergenic
1031472009 7:122177241-122177263 GGACACCCTGATGGATCCGGAGG - Intergenic
1032402074 7:131630479-131630501 GGGAACCAAAATGGATCAGGAGG - Intergenic
1033705186 7:143879776-143879798 GGGTACAATGGGGTATCTGGGGG - Intronic
1037714062 8:21382081-21382103 GGCCACCATGATGGGGCTGGTGG - Intergenic
1041897799 8:62946297-62946319 AGGCACCATGATGGGTCTGCTGG - Intronic
1046165600 8:110430517-110430539 GGGAACATAGATGGATCTGGAGG - Intergenic
1046456514 8:114471514-114471536 GGGTAATATGATGGATATGAGGG + Intergenic
1046628546 8:116600985-116601007 GGAGACCATGTTGGCTCTGGAGG - Intergenic
1046860678 8:119087771-119087793 GTATACCATGATGAATCTAGAGG + Intronic
1048054519 8:130850637-130850659 GGGTACCTTGATAGAAGTGGAGG + Intronic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1052672544 9:31576808-31576830 GGGCCCCATGATGGTACTGGTGG - Intergenic
1053789204 9:41674551-41674573 GGGTAACAGGAAGGATCGGGTGG + Intergenic
1054155936 9:61640212-61640234 GGGTAACAGGAAGGATCGGGTGG - Intergenic
1054177485 9:61885904-61885926 GGGTAACAGGAAGGATCGGGTGG + Intergenic
1054475707 9:65571212-65571234 GGGTAACAGGAAGGATCGGGTGG - Intergenic
1054660046 9:67694904-67694926 GGGTAACAGGAAGGATCGGGTGG - Intergenic
1055310532 9:74974857-74974879 GGCAACATTGATGGATCTGGAGG + Intergenic
1056655485 9:88505307-88505329 GGCTACCATGACGGATGAGGCGG - Intergenic
1186347185 X:8705847-8705869 GGTTACAATGATGGTTCTAGAGG - Intronic
1189590146 X:42502185-42502207 GGGTGCCACGGTGGATCTGAAGG + Intergenic
1190233878 X:48601539-48601561 GGGCAGCATGATGGCTCTGAAGG + Intronic
1190368114 X:49716722-49716744 GGACACCCTGCTGGATCTGGAGG - Intergenic
1192770753 X:74186895-74186917 GGGTGCCATGACAGGTCTGGAGG - Intergenic
1192961008 X:76130789-76130811 GGACACCCTGCTGGATCTGGAGG - Intergenic
1193237528 X:79126803-79126825 GGGAACATGGATGGATCTGGAGG + Intergenic
1195032930 X:100944263-100944285 GGGTGGCATGATGGACATGGAGG + Intergenic
1195259080 X:103115352-103115374 GGACACCCTGCTGGATCTGGAGG + Intergenic
1197654741 X:129104830-129104852 GGATACATTGATGGATTTGGTGG - Intergenic
1198862339 X:141084397-141084419 GGACACCCTGCTGGATCTGGAGG - Intergenic
1198900355 X:141502989-141503011 GGACACCCTGCTGGATCTGGAGG + Intergenic
1200072426 X:153535783-153535805 GGGTTCCCGAATGGATCTGGGGG + Intronic
1200415971 Y:2910304-2910326 GGACACCCTGCTGGATCTGGAGG + Intronic
1201421484 Y:13804594-13804616 GGACACCCTGCTGGATCTGGAGG - Intergenic
1201582023 Y:15519486-15519508 GGATACCCTGCTGGATCTGTGGG + Intergenic