ID: 1135992948

View in Genome Browser
Species Human (GRCh38)
Location 16:27228725-27228747
Sequence GAGTACCATGATGGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 3, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992948_1135992961 28 Left 1135992948 16:27228725-27228747 CCTCCAGATCCATCATGGTACTC 0: 1
1: 1
2: 3
3: 6
4: 133
Right 1135992961 16:27228776-27228798 CCTCCCCTCCAGATCCATCATGG 0: 4
1: 2
2: 17
3: 81
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992948 Original CRISPR GAGTACCATGATGGATCTGG AGG (reversed) Intronic
901719688 1:11186677-11186699 GAAAACCATGAAGGATGTGGAGG - Intronic
901815316 1:11790322-11790344 GAGTCCCAGGCTGGCTCTGGAGG + Exonic
903859369 1:26355641-26355663 GAGTACAGTGATGAACCTGGAGG + Intergenic
904716494 1:32471569-32471591 GAGTTCCATGATGGATGTCCAGG + Exonic
904735076 1:32625582-32625604 GAGTACCAAGCTGGAATTGGTGG + Intronic
906557703 1:46727666-46727688 CAGAAACATGATGGAGCTGGAGG + Intergenic
910537872 1:88320021-88320043 GATTCCCAATATGGATCTGGGGG - Intergenic
914220722 1:145679564-145679586 GTGCACCAAGATGGATCTGAAGG - Intronic
921719679 1:218456597-218456619 GTGTCCCATGATGGGACTGGTGG + Intergenic
921931164 1:220755440-220755462 GAGTACCAGGGTGGGTCAGGAGG + Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
1064867264 10:19895205-19895227 GAGGATGATGATGGGTCTGGAGG + Intronic
1068772983 10:60842893-60842915 GAGTACAATGATGAATGTGCTGG - Intergenic
1073334076 10:102692023-102692045 GAGTACAAGGATGCAGCTGGAGG + Intronic
1074836297 10:117299006-117299028 GAGGACTGTGATGGATATGGAGG - Intronic
1080150270 11:29044579-29044601 GGGAACCAGGATGGAGCTGGAGG + Intergenic
1082317008 11:50741970-50741992 GAGTGCCTTGAGGGATATGGTGG + Intergenic
1086022403 11:82247281-82247303 GGGTACCATCCTGGAACTGGGGG - Intergenic
1086412298 11:86554823-86554845 AAGAAACATGATGGATCTGTTGG - Intronic
1088149168 11:106723491-106723513 GTGTACCAGGAAGGTTCTGGTGG - Intronic
1088153726 11:106779163-106779185 GAATATAATGATAGATCTGGGGG - Intronic
1090983317 11:131743473-131743495 GAGTACTATGAAGGTTCTAGTGG - Intronic
1091628598 12:2141262-2141284 GAGGAGCAGGAAGGATCTGGAGG + Intronic
1092160140 12:6311267-6311289 GAATACCACCATGGAGCTGGGGG - Intronic
1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG + Intronic
1095603725 12:44043432-44043454 GAGGACCCTGATGAAGCTGGGGG + Intronic
1095633862 12:44408446-44408468 GAGAACCATGGTGGTTGTGGTGG + Intergenic
1096579013 12:52572469-52572491 GAGAAGCATGAGGGATCTGGTGG - Exonic
1097821796 12:64135179-64135201 GAGGACCCTGATGAAGCTGGGGG - Intronic
1099238216 12:80107795-80107817 CAGCAACATGATGGAGCTGGAGG + Intergenic
1099726121 12:86430599-86430621 GAGTACTGTGATGGATTTTGAGG + Intronic
1104896872 12:132168979-132169001 GAGTGCACTGAGGGATCTGGGGG + Intergenic
1106315511 13:28589966-28589988 ACGTACAATGATGGATCTGATGG + Intergenic
1106712651 13:32354592-32354614 GAGTACTATGATGGAATTAGAGG + Intronic
1107675538 13:42793037-42793059 GAGGATCATGATAGATATGGGGG + Intergenic
1111940530 13:94602063-94602085 GAGTTCCATGGTAGGTCTGGGGG + Exonic
1112130507 13:96518056-96518078 CAGGAACATGATGGAGCTGGGGG + Intronic
1112401681 13:99084206-99084228 GAGTACCAGGAAGGAGGTGGGGG + Intronic
1113206046 13:107917179-107917201 CAGAACCATGATGGAGATGGAGG - Intergenic
1115656003 14:35444413-35444435 GGCCACCATGATGGAACTGGTGG - Intergenic
1116555045 14:46292010-46292032 AAAAACCATGATGGAGCTGGAGG - Intergenic
1120257507 14:82139517-82139539 GACCCCCATGATGGAACTGGTGG - Intergenic
1120272767 14:82335627-82335649 TAGCAACATGATGGAACTGGAGG + Intergenic
1120989742 14:90364646-90364668 CAGTACCTTGTAGGATCTGGAGG - Intergenic
1123125470 14:105942917-105942939 GGATACCCTGATGGATCCGGAGG - Intergenic
1130517437 15:84636828-84636850 CAGTACCTAGATGGATATGGAGG + Intergenic
1133468481 16:6051283-6051305 GAGTACCAGGATGGATGGAGAGG - Intronic
1135108136 16:19668995-19669017 GCAAACCATGATGGAGCTGGAGG - Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1138683790 16:58706873-58706895 GAGTCCCATGAAGGATCCTGTGG - Intergenic
1142755510 17:2014228-2014250 GAGCAGCATGAGGGATCTGGAGG + Intronic
1142936239 17:3334439-3334461 CAGCAACATGATGGAACTGGGGG - Intergenic
1148795325 17:50194218-50194240 GAGAAGCATGATGGAGGTGGGGG + Intronic
1148967086 17:51445153-51445175 CAGGAACATGATGGAGCTGGAGG + Intergenic
1149451976 17:56756939-56756961 GAGTGCTATTATGTATCTGGAGG + Intergenic
1152325190 17:79631903-79631925 GAGAACCTTGAGGGATCTGCTGG - Intergenic
1153363318 18:4224379-4224401 GAGTACCAAGGGGGATCTTGGGG + Intronic
1157514211 18:48299331-48299353 GAATGTCATGATGGTTCTGGAGG - Intronic
1157723042 18:49940341-49940363 GAGTAGCAAGATGGTGCTGGTGG + Intronic
1159065187 18:63561737-63561759 CAGTAACATGATGGAAATGGAGG + Intronic
1165449226 19:35872565-35872587 GAGGGCCAAGATGGACCTGGAGG + Exonic
1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG + Intergenic
1166285456 19:41823875-41823897 GAGCAACATGGTGGAACTGGAGG + Intergenic
926197687 2:10773668-10773690 GAGTACCAAGCTGGGTGTGGTGG - Intronic
927955025 2:27201936-27201958 GTGTAGCAGGATGGACCTGGGGG - Intronic
932218702 2:69983819-69983841 CAGTACCATGATGGAACTGGGGG - Intergenic
937491577 2:122373826-122373848 GAGTACAATGATAGAAATGGTGG + Intergenic
937785545 2:125890335-125890357 GAGGACCCTGATGAAGCTGGGGG - Intergenic
938912800 2:135900946-135900968 CAGCAACATGATGGAGCTGGAGG + Intergenic
940749242 2:157606095-157606117 CAGCAACATGATGGAACTGGAGG - Intronic
941357509 2:164511812-164511834 GAGCACCAGGATGGTTCTGAGGG + Intronic
943787566 2:191895467-191895489 GCACACCATGGTGGATCTGGGGG + Intergenic
944360818 2:198854124-198854146 CAGTAACATGATGGAGCTGGAGG + Intergenic
945295260 2:208164129-208164151 GATTACCATGATTGATATGTTGG - Intergenic
946173463 2:217908894-217908916 GAGTCCGAGGATGGCTCTGGAGG + Intronic
946221779 2:218233793-218233815 AAGTACAATGTAGGATCTGGAGG + Intronic
947931830 2:233971223-233971245 GTGTGCTATGATAGATCTGGAGG + Intronic
948033895 2:234842096-234842118 GAGGACCATTATGGTTATGGGGG + Intergenic
1171057619 20:21922744-21922766 TAGGAACATGATGGAGCTGGAGG - Intergenic
1171386668 20:24774125-24774147 GCCTACCAAGATGGATCTGCAGG - Intergenic
1175539372 20:59738698-59738720 GAGTGTCAGGAAGGATCTGGAGG - Intronic
1178711604 21:34922103-34922125 GAGCAGCCTGCTGGATCTGGAGG + Intronic
1181428619 22:22862105-22862127 CAGCAACATGATGGAACTGGAGG + Intronic
951307396 3:21082079-21082101 CAGAAACATGATGGAGCTGGAGG - Intergenic
951358519 3:21698295-21698317 CAGCACCATGATGGGGCTGGAGG + Intronic
955820320 3:62889657-62889679 GAGTGCCTTGCTGGATTTGGGGG + Intergenic
956344451 3:68262575-68262597 CAGCAACATGATGGAGCTGGAGG - Intronic
957896895 3:86432708-86432730 AAGCAACATGATGGAGCTGGAGG + Intergenic
961081700 3:124033503-124033525 GGGTACCATGGGGGAGCTGGCGG + Intergenic
962048554 3:131787536-131787558 GCAGACCCTGATGGATCTGGCGG + Intronic
964591569 3:158368194-158368216 GAGTACAATGCTGGATCTCTGGG + Intronic
965308683 3:167100913-167100935 GATTTCCATTATGGCTCTGGAGG - Intergenic
972347591 4:38205855-38205877 GAGTACCATGATGGTGCAGAGGG - Intergenic
975773441 4:77756278-77756300 GAATACCAGGCTGGATGTGGTGG - Intronic
978716637 4:111851700-111851722 GAGTTCCATGATGGTCTTGGGGG - Intergenic
980843854 4:138300425-138300447 GAGTACCATGATGGATGCACAGG - Intergenic
981645621 4:146995561-146995583 CAGTAACATGATGTAGCTGGAGG + Intergenic
983409507 4:167379155-167379177 AAGAACCATGACAGATCTGGTGG + Intergenic
983581888 4:169317589-169317611 GAGGACCCTGATGAAGCTGGGGG + Intergenic
986154199 5:5157517-5157539 TAGTGACATGATGCATCTGGTGG + Intronic
989700267 5:44255609-44255631 GAGCCCCATGATGGGACTGGTGG + Intergenic
990355822 5:54965185-54965207 GAGTACAATGAAGCATGTGGAGG - Intergenic
992942878 5:81780115-81780137 GAGACCCAGGATGGAACTGGTGG - Intergenic
995976512 5:118042900-118042922 GCCTACAATGATGGAACTGGAGG + Intergenic
999602002 5:153277227-153277249 GTGTGCCATGCTGTATCTGGTGG + Intergenic
1005939523 6:30550494-30550516 GAGTAGGATGCTGGAGCTGGAGG - Intronic
1008186249 6:48394630-48394652 CAGGAACATGATGGAGCTGGAGG - Intergenic
1008564683 6:52755608-52755630 GAGTCCCACTATGTATCTGGAGG - Intronic
1008569005 6:52796937-52796959 GAGTCCCACTATGTATCTGGAGG - Intronic
1014692447 6:124578245-124578267 GAGTACCAAGCAGGATCTTGGGG + Intronic
1014752757 6:125272355-125272377 GAGTTCCAAGCTGGACCTGGTGG + Intronic
1015282559 6:131449594-131449616 GAGTAACCTGGTGGAACTGGGGG - Intergenic
1017748576 6:157469131-157469153 GAGTACCATGCTGGACATGTGGG - Intronic
1024059152 7:45685482-45685504 GAGTAACAAGATGGAGCTGGAGG + Intronic
1024059196 7:45685667-45685689 GAGTAACAGGTTGGAGCTGGGGG + Intronic
1027604902 7:80288154-80288176 GAGTATCATGTGGGATCTTGAGG + Intergenic
1031721930 7:125187472-125187494 GAGTACCAAGTTGGCTCTTGGGG + Intergenic
1034169588 7:149052693-149052715 GAGGACCCTGATGAAGCTGGGGG + Intergenic
1036627994 8:10487833-10487855 GACAGCTATGATGGATCTGGAGG - Intergenic
1045030022 8:98126134-98126156 AAGTTCCAGGATGGATGTGGTGG - Intronic
1045194238 8:99913801-99913823 GATTACCAGGCTGGATGTGGAGG - Intergenic
1045648916 8:104325193-104325215 GAGTGCCAGGCTGGATGTGGTGG + Intergenic
1046860678 8:119087771-119087793 GTATACCATGATGAATCTAGAGG + Intronic
1050578723 9:7028053-7028075 GAGTACCAAGCAGGATCTTGGGG - Intronic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1052665177 9:31486998-31487020 GAGGCCCATGGTAGATCTGGGGG - Intergenic
1053295648 9:36911231-36911253 GAGTACCATGGTGCCCCTGGTGG - Intronic
1058396087 9:104556321-104556343 GAATAGAATGATGGATCAGGTGG + Intergenic
1061053512 9:128209618-128209640 GAGTTCCGTGGTGGATGTGGAGG + Intronic
1192039905 X:67607974-67607996 GAGTTTCATGTTAGATCTGGGGG - Intronic
1193514534 X:82446888-82446910 GAGTAACATAAAGGACCTGGTGG + Intergenic
1195425875 X:104729800-104729822 CAGGAACATGATGGAGCTGGAGG - Intronic
1197290149 X:124645939-124645961 CAGCACCATGATAGATCTTGAGG - Intronic
1197853921 X:130894637-130894659 GAGTAACATGATTGCACTGGAGG - Intronic
1200222302 X:154397233-154397255 GAGTCCCATGATGGAAAGGGAGG + Intronic
1201624482 Y:15999234-15999256 GAGTACCCTGATGAAACTAGAGG - Intergenic