ID: 1135992963

View in Genome Browser
Species Human (GRCh38)
Location 16:27228780-27228802
Sequence GGTGCCATGATGGATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 2, 2: 5, 3: 19, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992963_1135992981 29 Left 1135992963 16:27228780-27228802 CCCTCCAGATCCATCATGGCACC 0: 1
1: 2
2: 5
3: 19
4: 130
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992963 Original CRISPR GGTGCCATGATGGATCTGGA GGG (reversed) Intronic
900406851 1:2496553-2496575 GGTGCCAGGCTGGCCCTGGACGG + Intronic
901217706 1:7563996-7564018 GGTGTCATGACTGATCTAGAAGG + Intronic
903656551 1:24952311-24952333 GGTGAGATGATGCATCTGGAAGG - Intronic
904293332 1:29501838-29501860 AATGCCATGATGGAACGGGAGGG - Intergenic
913052388 1:115129167-115129189 GAGGCCATGATGGATGTGGGAGG - Intergenic
920849701 1:209620327-209620349 GGTGCTATGATGGCCATGGAAGG + Intronic
922631552 1:227118992-227119014 GGTGCCAGGAAGGAGATGGAGGG - Intronic
923685921 1:236153926-236153948 GATGCCAGGATGGCTGTGGAGGG + Intronic
1063015728 10:2075154-2075176 GGTGGCAGGATGGAGCTGGATGG - Intergenic
1063298798 10:4833294-4833316 GGTGCCATGCTGGCTCTGGGTGG + Intronic
1067216445 10:44308105-44308127 GGTGCCTTGCTGGGCCTGGAGGG - Intergenic
1071435606 10:85646188-85646210 GGTGGCAGGATGGGTCTGGGAGG + Intronic
1072493084 10:95928081-95928103 GGGGACCTGAGGGATCTGGAGGG - Intronic
1073638084 10:105219945-105219967 GCAGCCATGATTGATTTGGAGGG - Intronic
1075193428 10:120332713-120332735 ATTCCCCTGATGGATCTGGAAGG + Intergenic
1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG + Intronic
1075941916 10:126397027-126397049 GGTGCCATTCTGGACCTTGAAGG - Intergenic
1076354224 10:129840415-129840437 GCTGCCATGGTGGGGCTGGACGG + Intronic
1076546058 10:131246378-131246400 GCGGCCATGCTGGACCTGGAGGG + Intronic
1081153462 11:39660733-39660755 GGTGCCATTGTGGATCTCAATGG + Intergenic
1082737615 11:56873951-56873973 GATGCCCTGCCGGATCTGGAGGG - Intergenic
1090554656 11:127861245-127861267 GGTACCATGATTGATGTGGTTGG + Intergenic
1099339474 12:81410102-81410124 GGTGCCATAATGGAAGTAGAAGG + Intronic
1099640228 12:85277055-85277077 GGAGCCAAGCTGGATCTGGACGG + Intergenic
1100527744 12:95435858-95435880 AGTGCCACGATGGAGCAGGATGG + Intergenic
1100682426 12:96941806-96941828 GGAACCATAATGAATCTGGAGGG - Intronic
1101236616 12:102796077-102796099 GGTGCTCTGGAGGATCTGGAAGG + Intergenic
1101601634 12:106214924-106214946 TCTGCCAGGATGGATCTGGTTGG - Intergenic
1102282137 12:111626790-111626812 GGGGCCATGAGGGAACAGGATGG + Intergenic
1102346513 12:112164261-112164283 GGTCTCATCATTGATCTGGAGGG + Exonic
1102682024 12:114697334-114697356 GCTGTCATTATGGAACTGGACGG + Intergenic
1107825528 13:44325700-44325722 GGTGGCCTGATGGATGTGAATGG - Intergenic
1111197170 13:84889679-84889701 TGTGGGATCATGGATCTGGAAGG + Intergenic
1112358675 13:98696656-98696678 GCTGCCATGGCTGATCTGGAAGG - Intronic
1112576706 13:100642720-100642742 GCTGCCATGATGGAGCTGCTGGG + Intronic
1116197145 14:41742651-41742673 GGGGCCATGATGGGTCAAGAAGG + Intronic
1117105425 14:52393652-52393674 GGGTCCATGAAAGATCTGGATGG - Intergenic
1117235850 14:53773911-53773933 GATGCCCTGATGCATCGGGATGG + Intergenic
1118468828 14:66056213-66056235 GGAGCCACCATGGATCTAGAAGG - Intergenic
1121526858 14:94625240-94625262 GGTGCCATGACAGAGCTGGTGGG + Intergenic
1121676224 14:95755066-95755088 GGTGCCATGATGGAGGTGGTGGG + Intergenic
1121867643 14:97377617-97377639 GGTGCCCTGATTGGTCTGGGGGG + Intergenic
1122001014 14:98653559-98653581 GATACCCTGCTGGATCTGGAAGG - Intergenic
1122685097 14:103500361-103500383 GAGGCCAAGCTGGATCTGGACGG - Intronic
1122826432 14:104373027-104373049 GGTGCCGTGTTGGCCCTGGATGG - Intergenic
1123009810 14:105343194-105343216 CGTGATAGGATGGATCTGGAAGG - Intronic
1123125469 14:105942916-105942938 GATACCCTGATGGATCCGGAGGG - Intergenic
1123130730 14:105983397-105983419 GGTGCCATCATAGGGCTGGATGG + Intergenic
1123580960 15:21714619-21714641 GGTGCCATCATAGGGCTGGATGG + Intergenic
1123617609 15:22157242-22157264 GGTGCCATCATAGGGCTGGATGG + Intergenic
1126909312 15:53401382-53401404 TGTGCCACAAAGGATCTGGAAGG + Intergenic
1128612879 15:69087964-69087986 GGTGAGATGATGGCTCAGGAGGG + Intergenic
1131076929 15:89501205-89501227 GGTGCCATGATCGATGTGGCTGG - Intergenic
1132652653 16:1028635-1028657 GGTGCCATGCAGGAGCAGGATGG - Intergenic
1133269068 16:4601859-4601881 GCTGCCAGGAGGGAGCTGGAGGG + Intergenic
1135816849 16:25642428-25642450 GGTTACAGGATGGATCTGGAAGG - Intergenic
1135992870 16:27228500-27228522 GGTGCCGTGATGGATCTGGAGGG - Intronic
1135992890 16:27228556-27228578 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992909 16:27228612-27228634 GGTACCATGATGGATCTGGAGGG - Intronic
1135992928 16:27228668-27228690 GGTGCTGTGATGGATCTGGAGGG - Intronic
1135992947 16:27228724-27228746 AGTACCATGATGGATCTGGAGGG - Intronic
1135992963 16:27228780-27228802 GGTGCCATGATGGATCTGGAGGG - Intronic
1135992983 16:27228836-27228858 GGTACCATGATGCATCTGGAGGG - Intronic
1135993002 16:27228892-27228914 GTTGCCATGATGGATCTGTAGGG - Intronic
1136088601 16:27902915-27902937 GGTGCCATGCTGCAGCTGGGAGG + Intronic
1137966697 16:52941802-52941824 GCTTCCATGATGGCGCTGGAAGG + Intergenic
1139695089 16:68668444-68668466 GGTGCCAGGAAGCATCTGGGAGG + Intronic
1140959553 16:79899051-79899073 GTTGTCATGGTGGAGCTGGAGGG - Intergenic
1141115224 16:81302858-81302880 GGTGCCATGAGAGATATAGATGG + Intergenic
1142410749 16:89915417-89915439 CGTGCCAAGATGCAGCTGGAGGG - Intronic
1146655362 17:34631735-34631757 GATGCCCTGAAGGCTCTGGAAGG - Intronic
1147217826 17:38911278-38911300 GGTGCCGAGATGGACCTTGAAGG + Intronic
1147350203 17:39836243-39836265 GGTGCCAGCATGGGTCTGGGTGG - Intronic
1147458032 17:40550735-40550757 GGTGCCACGGTGGATGTGCAGGG + Intergenic
1149580560 17:57747537-57747559 TGTGCCATCAGGGACCTGGAAGG - Intergenic
1151468858 17:74305307-74305329 GGGGCCATGATGGCCCGGGAAGG - Exonic
1153617633 18:6949156-6949178 GGAACCATGCTGGATGTGGAGGG - Exonic
1157092070 18:44648475-44648497 AGTGCCATGCTGGAACTGGGTGG + Intergenic
1158362027 18:56685534-56685556 TGTGCAATGAAGTATCTGGAAGG + Intronic
1161055715 19:2189848-2189870 GGTGACATAAGGGGTCTGGAGGG - Intronic
1161152780 19:2718295-2718317 GGTGGCATGATGGCTCGGCAAGG - Intronic
1165396885 19:35569358-35569380 CCTGCCCTCATGGATCTGGAGGG - Intergenic
1166165657 19:40986575-40986597 GACACCATGCTGGATCTGGAGGG + Intergenic
1166897651 19:46033927-46033949 GTTACAATGATGGATCCGGATGG - Intergenic
1167191764 19:47995189-47995211 GCTGCCATATTGGTTCTGGAAGG + Intronic
927889267 2:26738359-26738381 GGTGGCTGGATGGATGTGGAAGG - Intergenic
928211598 2:29327921-29327943 GGAGGCATGAAGGATCTGTAAGG + Intronic
936008874 2:108912084-108912106 GGTGCTCTGAGGGCTCTGGAGGG + Intronic
937470248 2:122168313-122168335 GGACACATGATGGATATGGATGG + Intergenic
938100852 2:128497301-128497323 GGTGGCATTTAGGATCTGGATGG - Intergenic
943699029 2:190970137-190970159 GTAGCCATCATGGATCTGGTAGG - Exonic
943753714 2:191536712-191536734 GATTCCATGGTGGATCTTGAAGG + Intergenic
943923103 2:193736281-193736303 GGTGCCATGATGGCTTTGAAGGG - Intergenic
946338597 2:219054789-219054811 GGAGCCAGCATGGATCTGGCTGG - Exonic
946773208 2:223110823-223110845 GGTGCCAGGGTGGAGCTGGAAGG + Intronic
947759830 2:232595910-232595932 GGTGTCATGTGGTATCTGGATGG + Intergenic
947931831 2:233971224-233971246 TGTGCTATGATAGATCTGGAGGG + Intronic
949031706 2:241800177-241800199 GGTGCAGTGATGGGTCTGGTGGG + Intronic
1170264178 20:14446497-14446519 GGAGCCAGGATGAACCTGGAAGG + Intronic
1173030550 20:39355023-39355045 TGTGACAATATGGATCTGGAAGG + Intergenic
1173072115 20:39778429-39778451 GATGGCATGATGGTTCAGGATGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1175377608 20:58540109-58540131 GGTACCATGGTGGATCAGGCTGG - Intergenic
1175524614 20:59624967-59624989 GATGTCATGCGGGATCTGGATGG - Intronic
1176828038 21:13717743-13717765 CGTGCCATGATCAATCTGCAGGG + Intergenic
1179539332 21:42073993-42074015 GGTGCCACGGGGGAGCTGGAGGG + Intronic
1179818162 21:43921300-43921322 GGTGTTATGAAGGATCCGGATGG - Intronic
1181461439 22:23088433-23088455 GGTGCCAAGGTGGAGCTGGCAGG + Intronic
1181859361 22:25806179-25806201 GGTGCGATGAGGGATGTGAAGGG + Intronic
1184256894 22:43292225-43292247 GCTGCCAAGATGGCTGTGGAAGG + Intronic
1185179448 22:49350636-49350658 GGTGCCCTGGAGGATGTGGAGGG - Intergenic
951864765 3:27295275-27295297 TTTGCCATCATGGATCTTGATGG - Intronic
953350718 3:42213721-42213743 GGGGGCTTGATGGGTCTGGAAGG + Intronic
960155325 3:114292611-114292633 GGTGCCAAGGTTGAACTGGAGGG - Intronic
960160541 3:114345797-114345819 GGTGTCAACATGGATGTGGAAGG - Intronic
961091646 3:124118040-124118062 GGAGGCAAGATGGATCTGGGAGG - Intronic
961368064 3:126413904-126413926 GGTGCCTTGCTGGAGGTGGAAGG + Intronic
962263567 3:133929797-133929819 GCTGCCATGATGGATGGGGCAGG - Exonic
964939309 3:162135768-162135790 GGTGACCAGATGGATCTGAAAGG - Intergenic
966230194 3:177642945-177642967 TGTGCCATGATGTACCTTGATGG + Intergenic
967015346 3:185476624-185476646 GGCTCCATGGTTGATCTGGAAGG - Intronic
967943465 3:194784122-194784144 GGTGCCATCTTGGACCAGGAAGG + Intergenic
973938638 4:55879470-55879492 GGGGGCAGGGTGGATCTGGAAGG + Intronic
986017898 5:3774181-3774203 GCTGCCATGATGGATTAGAAAGG + Intergenic
987306179 5:16639949-16639971 GGTGGCAGGATGGATGTGAAGGG + Intergenic
994074528 5:95635593-95635615 GATACCATGGTGGATCTGGATGG - Intergenic
998884969 5:146684651-146684673 GTTTCCACGATGCATCTGGAGGG - Intronic
999321540 5:150618432-150618454 GCTTCCATCAGGGATCTGGAAGG - Exonic
1001422814 5:171600222-171600244 GGTCCCATGATGGATGGGCAGGG - Intergenic
1003795718 6:9600741-9600763 ACTGGCATGATGGATCTGAAAGG - Intronic
1005152828 6:22772421-22772443 GGTGCCAAGAAGAATCTGAATGG + Intergenic
1012086408 6:94831477-94831499 GGTGTCATGAGGGATGTGGTGGG - Intergenic
1013312348 6:108907794-108907816 GCTGCCAAGCTGGATCTTGATGG - Intronic
1014208921 6:118687803-118687825 GGTGCCCTGCCAGATCTGGAGGG - Intronic
1016617812 6:146073194-146073216 GGAGAAATGATGGATCTGTAGGG + Intronic
1018876323 6:167826147-167826169 GGTGCAGTGCTGGATCTGGACGG - Intergenic
1020474585 7:8580798-8580820 GGTGCCCTAATTGCTCTGGAAGG - Intronic
1020983797 7:15107153-15107175 GGCAACATGATGAATCTGGAAGG - Intergenic
1021939794 7:25668435-25668457 GGGGCAACGATGGATCTGGATGG - Intergenic
1022242912 7:28530266-28530288 GGAGCCATGCTTGACCTGGAAGG + Intronic
1022569558 7:31438413-31438435 GGTAGCATGATGGATCTGTAAGG + Intergenic
1023136682 7:37059741-37059763 GGTGCCATGAGGTCTCTGGTGGG - Intronic
1028113347 7:86969065-86969087 TGTGCCATGATTTATATGGAAGG - Intronic
1033542658 7:142371759-142371781 GAAGGCAGGATGGATCTGGAGGG + Intergenic
1042001401 8:64126550-64126572 GATGGCAGCATGGATCTGGAAGG + Intergenic
1047365711 8:124209370-124209392 GATGTCATCAAGGATCTGGATGG - Intergenic
1049962592 9:750850-750872 GTTGCCATGAGGGAGCTGGAAGG + Intergenic
1053544532 9:39009397-39009419 GGTGCCAGCATGGCTCTGGATGG - Intergenic
1053808964 9:41832879-41832901 GGTGCCAGCATGGCTCTGGATGG - Intergenic
1054621628 9:67354549-67354571 GGTGCCAGCATGGCTCTGGATGG + Intergenic
1055014830 9:71604973-71604995 GGTGGCCTGATGGGTATGGAGGG - Intergenic
1058140236 9:101350033-101350055 ATTGCCATTATGGATATGGATGG - Intergenic
1058194136 9:101953308-101953330 TTGGCCATCATGGATCTGGATGG - Intergenic
1062091672 9:134681626-134681648 GGTGCCATGCTGGGGCTGCAAGG - Intronic
1062197045 9:135280116-135280138 GTAGCCATGATGGGTCTGGCTGG + Intergenic
1203519318 Un_GL000213v1:31798-31820 CGTGCCATGATCAATCTGCAGGG - Intergenic
1192207127 X:69103815-69103837 AGTGCCTTGTTGGATGTGGAGGG + Intergenic