ID: 1135992964

View in Genome Browser
Species Human (GRCh38)
Location 16:27228781-27228803
Sequence GGGTGCCATGATGGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 2, 2: 6, 3: 14, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992964_1135992981 28 Left 1135992964 16:27228781-27228803 CCTCCAGATCCATCATGGCACCC 0: 1
1: 2
2: 6
3: 14
4: 161
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992964 Original CRISPR GGGTGCCATGATGGATCTGG AGG (reversed) Intronic
903044945 1:20557530-20557552 GGGAGCCAGGATGGCACTGGTGG - Intergenic
903189553 1:21649120-21649142 GGGTGCCACGATGTATCCCGAGG + Intronic
905870221 1:41399327-41399349 GGGTGCCAAGACGGGCCTGGCGG - Intergenic
905967315 1:42109677-42109699 GGCTGTCATGATGGGACTGGTGG + Intergenic
911472285 1:98333366-98333388 GGGTGCCAGGCTTGATCTAGAGG - Intergenic
911683854 1:100750244-100750266 GGGTGCCATGGGGCATATGGAGG - Intergenic
912692262 1:111813187-111813209 GGGTTCCAAGAGTGATCTGGGGG - Intronic
915275344 1:154784490-154784512 GGGTGGGACGCTGGATCTGGAGG - Intronic
915282533 1:154832411-154832433 GGATGCCAGGACAGATCTGGGGG - Intronic
916057111 1:161075296-161075318 GGATGCCTTGAGGGAACTGGAGG + Intronic
916325715 1:163557612-163557634 GGGTGTCAGGAAGGAACTGGGGG - Intergenic
917597919 1:176548291-176548313 TGGGGGCATGTTGGATCTGGGGG + Intronic
921719679 1:218456597-218456619 GTGTCCCATGATGGGACTGGTGG + Intergenic
922385423 1:225076260-225076282 TGGTGCCAGGGTGGGTCTGGAGG + Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
922995216 1:229951912-229951934 GGCCCCCATGATGGAACTGGAGG + Intergenic
923010389 1:230083487-230083509 GGCTGGGATGATGGAGCTGGGGG + Intronic
923073690 1:230590116-230590138 GGGTGCCAGGATGGAAAAGGAGG + Intergenic
1063345916 10:5312372-5312394 GGCTCCCATGATGGGCCTGGTGG - Intergenic
1066521480 10:36224833-36224855 GGCTGCCATGCTGGATTTGAAGG - Intergenic
1067533261 10:47089865-47089887 GGGTTCCATCATGGATCAAGGGG + Intergenic
1067794113 10:49308294-49308316 GGGTGCCATGATGGCAGTGTTGG - Intronic
1072493085 10:95928082-95928104 GGGGGACCTGAGGGATCTGGAGG - Intronic
1073930134 10:108566388-108566410 GGCTGCCATGATGAAGGTGGCGG + Intergenic
1074850284 10:117433988-117434010 GGGTGCCAGCATGGGGCTGGGGG - Intergenic
1074964355 10:118476094-118476116 GGGGGCCAGGCTGGATCAGGAGG - Intergenic
1075004482 10:118820245-118820267 GGGTGCCATAAAAGAGCTGGGGG + Intergenic
1076200430 10:128553401-128553423 GGGTGCCGTGATGCAGCTGCTGG - Intergenic
1076546057 10:131246377-131246399 GGCGGCCATGCTGGACCTGGAGG + Intronic
1077012750 11:386098-386120 GGAGGCCAAGATGGAGCTGGGGG + Intergenic
1077096167 11:800053-800075 GGGTGACATGGTGGAGTTGGGGG - Intronic
1079492620 11:21006249-21006271 GGATCCCATGATGGGACTGGTGG + Intronic
1080150270 11:29044579-29044601 GGGAACCAGGATGGAGCTGGAGG + Intergenic
1080375517 11:31705300-31705322 GGGCCCCATGATGGGACTGGTGG - Intronic
1082317008 11:50741970-50741992 GAGTGCCTTGAGGGATATGGTGG + Intergenic
1082737616 11:56873952-56873974 GGATGCCCTGCCGGATCTGGAGG - Intergenic
1084659217 11:70537256-70537278 GGCTGCCATGCTGGCCCTGGGGG - Intronic
1084967215 11:72751069-72751091 GGGGGCCATCAGGGCTCTGGTGG + Intronic
1086022403 11:82247281-82247303 GGGTACCATCCTGGAACTGGGGG - Intergenic
1086174783 11:83878127-83878149 GGGTGCTATTATGGATATGTAGG - Intronic
1087339442 11:96884306-96884328 GGGTGAGATGATGGGGCTGGGGG + Intergenic
1087918533 11:103838286-103838308 GGCTGCATGGATGGATCTGGAGG + Intergenic
1091812571 12:3411709-3411731 GGGCCCCATGATGAAACTGGTGG + Intronic
1100591581 12:96035169-96035191 GGGTGCTGTGAGAGATCTGGGGG + Intronic
1101847593 12:108375097-108375119 GGCTGCCAGGCTGGATCTAGGGG - Intergenic
1103379086 12:120479978-120480000 GGGTGGCATGATCAGTCTGGGGG + Intronic
1104896872 12:132168979-132169001 GAGTGCACTGAGGGATCTGGGGG + Intergenic
1105003583 12:132707051-132707073 GGATGCCGTGAAGGATGTGGCGG + Intergenic
1106358170 13:29004770-29004792 GGGTGTTATGAAGGATATGGAGG + Intronic
1112576705 13:100642719-100642741 TGCTGCCATGATGGAGCTGCTGG + Intronic
1113759558 13:112837917-112837939 GGGTGCCATGGCTGCTCTGGGGG + Intronic
1115656003 14:35444413-35444435 GGCCACCATGATGGAACTGGTGG - Intergenic
1121526857 14:94625239-94625261 AGGTGCCATGACAGAGCTGGTGG + Intergenic
1121676223 14:95755065-95755087 AGGTGCCATGATGGAGGTGGTGG + Intergenic
1121867642 14:97377616-97377638 TGGTGCCCTGATTGGTCTGGGGG + Intergenic
1122054182 14:99081350-99081372 GGCTGCCATGCCGGTTCTGGTGG - Intergenic
1122298995 14:100721433-100721455 GGGTGCAATGATGGATTTGAAGG - Intergenic
1122968843 14:105144254-105144276 GGGCGCCATCAGGGATGTGGTGG - Intronic
1123125470 14:105942917-105942939 GGATACCCTGATGGATCCGGAGG - Intergenic
1125504221 15:40257711-40257733 TGGGGCCCTGATGGCTCTGGTGG + Intronic
1127034341 15:54898497-54898519 GGATGGCATAATGGATATGGTGG - Intergenic
1128612878 15:69087963-69087985 GGGTGAGATGATGGCTCAGGAGG + Intergenic
1132237589 15:100233797-100233819 GGGTGCCAAGCTGGAGATGGAGG + Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1139661394 16:68423414-68423436 GGGATCCATGATGGGGCTGGCGG + Intronic
1142161852 16:88561898-88561920 GGGGGCCATGATGGAAGTGGGGG + Intergenic
1143090977 17:4449003-4449025 TGCTGCCAGGAAGGATCTGGAGG + Intronic
1146910794 17:36647210-36647232 GGGTGCCATGGCTGATTTGGTGG + Intergenic
1147458031 17:40550734-40550756 GGGTGCCACGGTGGATGTGCAGG + Intergenic
1147673752 17:42191328-42191350 GGGAGCCAGGAAGGATGTGGTGG - Intronic
1149451976 17:56756939-56756961 GAGTGCTATTATGTATCTGGAGG + Intergenic
1157514211 18:48299331-48299353 GAATGTCATGATGGTTCTGGAGG - Intronic
1158480270 18:57815686-57815708 GGTTGCCATCTTGGATCTGAGGG + Intergenic
1159369441 18:67512724-67512746 TGGTGCCATGATGGATGTGTGGG - Exonic
1160969456 19:1761006-1761028 GGAAGCCATGATGGAGGTGGAGG - Intronic
1161948464 19:7453745-7453767 GGGTGCCATCTTGGATCAGTGGG + Intronic
1161948518 19:7454041-7454063 GGGTGCCATCTTGGATCAGTGGG + Intronic
1162206922 19:9063200-9063222 GGGAGCGATGAGGGATTTGGAGG - Intergenic
1165449226 19:35872565-35872587 GAGGGCCAAGATGGACCTGGAGG + Exonic
1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG + Intergenic
1166661743 19:44651709-44651731 TGATGCCATGAGGGAGCTGGTGG - Intronic
925216819 2:2103600-2103622 GGGTGCCATGAGGGCTGTGCTGG - Intronic
931401270 2:61933524-61933546 GTGAGCCATGATGGGCCTGGTGG + Intronic
932218702 2:69983819-69983841 CAGTACCATGATGGAACTGGGGG - Intergenic
935539601 2:104334035-104334057 GGCTTCCATGATGGGACTGGTGG + Intergenic
936008873 2:108912083-108912105 GGGTGCTCTGAGGGCTCTGGAGG + Intronic
940851523 2:158691700-158691722 GGGTGCCCGGGTGGGTCTGGTGG - Intergenic
940859716 2:158759172-158759194 GGCCCCCATGATGGACCTGGTGG + Intergenic
941198075 2:162474900-162474922 AGCTGCCATGATTGCTCTGGAGG + Intronic
943923104 2:193736282-193736304 AGGTGCCATGATGGCTTTGAAGG - Intergenic
943955681 2:194186410-194186432 GGGTGCATGGATGGAACTGGAGG - Intergenic
946068938 2:217014650-217014672 GGGGGCCATGAGGGAGGTGGGGG + Intergenic
947931830 2:233971223-233971245 GTGTGCTATGATAGATCTGGAGG + Intronic
947991920 2:234495496-234495518 GGGGGGCATGTTGGTTCTGGGGG - Exonic
948507129 2:238435819-238435841 GGGGGCCGAGGTGGATCTGGTGG + Exonic
949031705 2:241800176-241800198 GGGTGCAGTGATGGGTCTGGTGG + Intronic
1169297716 20:4414347-4414369 GGGTGCCATGAAAAATTTGGGGG - Intergenic
1169839151 20:9915526-9915548 GGGTGAAATGATGGATAAGGAGG + Intergenic
1169907286 20:10616755-10616777 GGGTGCTATGTTAGATATGGTGG - Intronic
1172008620 20:31833770-31833792 GGGGGCACTGATGGCTCTGGGGG + Exonic
1173812978 20:45967827-45967849 GGAGGCCATGATGGAGGTGGTGG - Exonic
1173869441 20:46332327-46332349 GGGAGCGGTGGTGGATCTGGGGG + Intergenic
1174165795 20:48582753-48582775 GGGGGCCATGATGGATGATGGGG - Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1175539372 20:59738698-59738720 GAGTGTCAGGAAGGATCTGGAGG - Intronic
1176828037 21:13717742-13717764 GCGTGCCATGATCAATCTGCAGG + Intergenic
1179398423 21:41062014-41062036 AGGAGCCATGTTGGATGTGGTGG - Intergenic
1182712005 22:32329010-32329032 TGGTGCCAGCATGGCTCTGGGGG + Intergenic
1184773893 22:46613677-46613699 GGGTGCCAGGATGGGGCTAGAGG + Intronic
1185179449 22:49350637-49350659 GGGTGCCCTGGAGGATGTGGAGG - Intergenic
1185260004 22:49856437-49856459 GGTTGCCCTGAAGGGTCTGGGGG + Intronic
1185393103 22:50573204-50573226 GGGTGCCAGGCTGGGCCTGGAGG + Intronic
953220653 3:40969082-40969104 AGTTGCCATCATGGACCTGGTGG + Intergenic
953531182 3:43741020-43741042 GGGGGCCATGATGGGTCAGATGG + Intergenic
954396627 3:50296679-50296701 GGGGGCCCTGATGGAACTGGGGG + Exonic
954711993 3:52509793-52509815 GGGAGCCAGGATGGGTTTGGGGG - Intronic
955820320 3:62889657-62889679 GAGTGCCTTGCTGGATTTGGGGG + Intergenic
956465027 3:69511579-69511601 GGGTGGCCTGAAGGATCTAGAGG - Intronic
961081700 3:124033503-124033525 GGGTACCATGGGGGAGCTGGCGG + Intergenic
961411347 3:126723068-126723090 GGGTGCCAAGATGGTTCAGTGGG - Intronic
963901774 3:150740046-150740068 GGGTGCCGTGAGGGCCCTGGAGG + Intergenic
964749037 3:160037998-160038020 GGGCTCCAGGGTGGATCTGGAGG - Intergenic
969690835 4:8703264-8703286 GGGTGCCAGGCAGGTTCTGGTGG + Intergenic
970705409 4:18795596-18795618 GGCTCCCATGATGGGACTGGTGG - Intergenic
974462582 4:62206846-62206868 GGCTTGCATGATGGATTTGGGGG + Intergenic
977282675 4:95061450-95061472 GTGTGGGATGATGGAGCTGGAGG + Intronic
979180316 4:117718395-117718417 GGGTGCCAGAATGGAAATGGTGG - Intergenic
980248106 4:130274084-130274106 AGGAGCCAACATGGATCTGGGGG + Intergenic
981748480 4:148072419-148072441 GGGAGCCAGGGTGGCTCTGGTGG - Exonic
986154199 5:5157517-5157539 TAGTGACATGATGCATCTGGTGG + Intronic
987306178 5:16639948-16639970 GGGTGGCAGGATGGATGTGAAGG + Intergenic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
997416570 5:133732937-133732959 GTGTGGCATGAGGGGTCTGGTGG - Intergenic
999602002 5:153277227-153277249 GTGTGCCATGCTGTATCTGGTGG + Intergenic
1001422815 5:171600223-171600245 GGGTCCCATGATGGATGGGCAGG - Intergenic
1005807025 6:29483649-29483671 GGGTGCCAGAATGGAGCTAGAGG - Intergenic
1008492923 6:52104556-52104578 GGATTCCATTATGGTTCTGGAGG - Intergenic
1010322928 6:74534038-74534060 TGGTGTCATGATGGACCTTGAGG - Intergenic
1011987338 6:93465259-93465281 GGATGCCATGATGCTTCTGTGGG + Intergenic
1012086409 6:94831478-94831500 AGGTGTCATGAGGGATGTGGTGG - Intergenic
1012204439 6:96442957-96442979 GGGTTCCAGGATGGTACTGGGGG - Intergenic
1013699376 6:112745622-112745644 GGGTGCCATGTTTTCTCTGGTGG + Intergenic
1015439829 6:133234936-133234958 GGCTCCCATGATGGAACTAGTGG - Intergenic
1015522291 6:134143796-134143818 GGGTCCCATGATGGGACTGATGG + Intergenic
1016617811 6:146073193-146073215 GGGAGAAATGATGGATCTGTAGG + Intronic
1016876558 6:148871057-148871079 GGCTGCCATGATGGGATTGGGGG + Intronic
1016936598 6:149452627-149452649 TGCTGCCAGGATGGCTCTGGGGG + Exonic
1017995798 6:159530796-159530818 TGCTGCCATGATGGTGCTGGAGG - Intergenic
1019917536 7:4143442-4143464 GGGTGCCAGGAGGGCTCTGGGGG - Intronic
1022011239 7:26309740-26309762 GGGTGCCCTGTTGGATGTAGGGG + Intronic
1022627289 7:32050965-32050987 AGGAGCCATGAGGGATCAGGTGG - Intronic
1023136683 7:37059742-37059764 TGGTGCCATGAGGTCTCTGGTGG - Intronic
1025126198 7:56347059-56347081 GGGTTCCAGGATAGATATGGTGG + Intergenic
1028318979 7:89437171-89437193 GGGTGCCAAGATGGAAGGGGGGG - Intergenic
1029711234 7:102301105-102301127 GGCTGCCAAGGTGGAGCTGGTGG + Exonic
1035596695 8:863901-863923 GGGTGCCGCAATGGACCTGGGGG - Intergenic
1036627994 8:10487833-10487855 GACAGCTATGATGGATCTGGAGG - Intergenic
1036634271 8:10538307-10538329 GGCTGCCAGGTTGGCTCTGGAGG - Intronic
1038414096 8:27380683-27380705 TGGTGCCACGATGGATCTCAGGG - Intronic
1041145938 8:54875754-54875776 GGTTGCCATGCTGGCTCAGGTGG - Intergenic
1042040452 8:64583479-64583501 GGGAGCTGTGATGGATCTGTTGG + Exonic
1045648916 8:104325193-104325215 GAGTGCCAGGCTGGATGTGGTGG + Intergenic
1048071608 8:131027494-131027516 GGGTGGCTTGATGAATCTTGGGG + Intronic
1049140278 8:140948374-140948396 GGGAGACATGCTGGAACTGGGGG + Intronic
1049757802 8:144318545-144318567 GGGTGCCCTGACGGAGCAGGCGG - Exonic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1052672544 9:31576808-31576830 GGGCCCCATGATGGTACTGGTGG - Intergenic
1059695288 9:116724651-116724673 GGGAGCCAGGAGGGATCTGAAGG - Intronic
1203519319 Un_GL000213v1:31799-31821 GCGTGCCATGATCAATCTGCAGG - Intergenic
1189590146 X:42502185-42502207 GGGTGCCACGGTGGATCTGAAGG + Intergenic
1190333116 X:49247888-49247910 GGGAGCCATTAGGGATCTGTGGG + Intronic
1192770753 X:74186895-74186917 GGGTGCCATGACAGGTCTGGAGG - Intergenic
1195032930 X:100944263-100944285 GGGTGGCATGATGGACATGGAGG + Intergenic
1197992674 X:132334849-132334871 GGAAGCTATGATGTATCTGGGGG - Intergenic
1200072426 X:153535783-153535805 GGGTTCCCGAATGGATCTGGGGG + Intronic
1200226818 X:154422127-154422149 GGTTGCCCAGATGGAGCTGGGGG + Intergenic