ID: 1135992981

View in Genome Browser
Species Human (GRCh38)
Location 16:27228832-27228854
Sequence CCTCCCCTCCAGATGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 4, 2: 4, 3: 49, 4: 259}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992965_1135992981 25 Left 1135992965 16:27228784-27228806 CCAGATCCATCATGGCACCCCAC 0: 1
1: 3
2: 4
3: 7
4: 119
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992969_1135992981 6 Left 1135992969 16:27228803-27228825 CCACACCCCCAACCACCGCCCTC 0: 1
1: 1
2: 13
3: 207
4: 1591
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992964_1135992981 28 Left 1135992964 16:27228781-27228803 CCTCCAGATCCATCATGGCACCC 0: 1
1: 2
2: 6
3: 14
4: 161
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992973_1135992981 -2 Left 1135992973 16:27228811-27228833 CCAACCACCGCCCTCTTCCGCCC 0: 1
1: 0
2: 4
3: 33
4: 407
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992971_1135992981 0 Left 1135992971 16:27228809-27228831 CCCCAACCACCGCCCTCTTCCGC 0: 1
1: 0
2: 0
3: 25
4: 290
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992970_1135992981 1 Left 1135992970 16:27228808-27228830 CCCCCAACCACCGCCCTCTTCCG 0: 1
1: 0
2: 2
3: 30
4: 260
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992968_1135992981 7 Left 1135992968 16:27228802-27228824 CCCACACCCCCAACCACCGCCCT 0: 1
1: 0
2: 10
3: 81
4: 752
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992972_1135992981 -1 Left 1135992972 16:27228810-27228832 CCCAACCACCGCCCTCTTCCGCC 0: 1
1: 0
2: 1
3: 21
4: 218
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992966_1135992981 19 Left 1135992966 16:27228790-27228812 CCATCATGGCACCCCACACCCCC 0: 1
1: 0
2: 4
3: 51
4: 496
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992974_1135992981 -6 Left 1135992974 16:27228815-27228837 CCACCGCCCTCTTCCGCCCTCCC 0: 1
1: 2
2: 31
3: 162
4: 1785
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992963_1135992981 29 Left 1135992963 16:27228780-27228802 CCCTCCAGATCCATCATGGCACC 0: 1
1: 2
2: 5
3: 19
4: 130
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992962_1135992981 30 Left 1135992962 16:27228779-27228801 CCCCTCCAGATCCATCATGGCAC 0: 1
1: 4
2: 5
3: 13
4: 154
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992975_1135992981 -9 Left 1135992975 16:27228818-27228840 CCGCCCTCTTCCGCCCTCCCCTC 0: 1
1: 4
2: 23
3: 350
4: 3526
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259
1135992967_1135992981 8 Left 1135992967 16:27228801-27228823 CCCCACACCCCCAACCACCGCCC 0: 1
1: 1
2: 12
3: 145
4: 1285
Right 1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG 0: 1
1: 4
2: 4
3: 49
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992981 Original CRISPR CCTCCCCTCCAGATGCATCA TGG Intronic
900123317 1:1058819-1058841 CCATCCCTCCAGACGCATCAGGG - Intergenic
900725753 1:4215510-4215532 CCTCCCCTCCTGATGCAAACAGG + Intergenic
900946654 1:5834674-5834696 CCACCCCTCGAGGTGGATCACGG - Intergenic
901123530 1:6913426-6913448 CCTCCCCAGCAGAGCCATCATGG + Intronic
902245995 1:15120752-15120774 CATCCCCTCCAGCTGCCTCTCGG + Intergenic
902957538 1:19935822-19935844 CCTGCCCTCCAGATGCTTCCAGG - Intergenic
903337423 1:22634474-22634496 CCTTCCCTTCACCTGCATCATGG + Intergenic
904440490 1:30526539-30526561 CCTGCCCTGCAGATGCATGGTGG - Intergenic
906582997 1:46952052-46952074 CCATCCCTCCAGATCCAGCAGGG + Intergenic
907758461 1:57334145-57334167 CCTGGCCTCCATATTCATCATGG - Intronic
909469158 1:76007275-76007297 TGACCCCTCCAGATGCACCAAGG + Intergenic
910927292 1:92410226-92410248 CCTCCTCTCCAGGTGTAACAGGG - Intergenic
915918724 1:159958343-159958365 CCTCTCCTCAATAGGCATCATGG - Intergenic
918173027 1:182016240-182016262 CCTCCCCTCCAACAGAATCAGGG - Intergenic
918413595 1:184285414-184285436 CCTCCCTTACAGAAGCATCAAGG + Intergenic
920347282 1:205314349-205314371 CATCCCCTGCAGCTGCAGCATGG - Intronic
923663672 1:235980115-235980137 CCTCCCCAGCAGAAGCAACACGG - Intronic
1062946035 10:1462972-1462994 CCTCCACTCCGGATGCAGTAGGG + Intronic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1064097509 10:12434910-12434932 CCTCCCCTCCTGATTCCTCCTGG - Intronic
1064183936 10:13143947-13143969 ACTCCCACCCAGATGCATGAGGG - Intergenic
1067757610 10:49016784-49016806 CCTCCACTACAGCTGCTTCAGGG + Exonic
1068988840 10:63130968-63130990 CCACCCCTCTGGATCCATCAGGG - Intergenic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1073130491 10:101185768-101185790 CCTGTCCTCCAGATGCTACAGGG - Intergenic
1073219087 10:101854638-101854660 CCTTACCTCCAGAGGCTTCAGGG - Intronic
1073368445 10:102965001-102965023 CCTCCCCTCCAGAGGATGCAAGG + Intronic
1074192022 10:111146368-111146390 GCTCCCCTGCAGTTACATCAAGG + Intergenic
1074978457 10:118599842-118599864 CCACCCCTCTGGATGCAGCAGGG - Intergenic
1075807412 10:125200017-125200039 CCTCTCTTCCAGCTGCAGCATGG + Intergenic
1075903298 10:126060783-126060805 CCTCCCCTCCAGATCCAGGCAGG + Intronic
1078191869 11:9097735-9097757 CCACCCCTCCAGATCCGGCAGGG + Intronic
1079933248 11:26590768-26590790 CCACCCCTCCGGATCCAGCAGGG - Intronic
1080881476 11:36325314-36325336 CCAACCCTCCAGATCCAGCAGGG - Intronic
1081739750 11:45430521-45430543 CCCCTCCTACAGATGCATCCAGG - Intergenic
1081740097 11:45433074-45433096 CCTCCCCTCAAGGGGCTTCAGGG + Intergenic
1082737613 11:56873947-56873969 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1082778426 11:57266700-57266722 CCTCTCTTTCAGATGCTTCAGGG - Intergenic
1082814857 11:57501091-57501113 CCTCCCCTCCCCCTGCAGCACGG + Intronic
1083815725 11:65131362-65131384 CCTCCCCTCAGGCTTCATCAAGG - Exonic
1083818758 11:65153755-65153777 CCTCCCCTCCACATGTCACAAGG - Intergenic
1085397743 11:76215569-76215591 CCTCCCCTTCAGTTACCTCAGGG + Intergenic
1086511201 11:87559874-87559896 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1087850737 11:103026792-103026814 CTTCCCCTCCTGCTGCATCTGGG - Intergenic
1087901293 11:103644845-103644867 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1090062438 11:123475795-123475817 CCTCCACTCCAGATTAGTCAAGG - Intergenic
1090332649 11:125943763-125943785 CCTCACCTCCCGAGGCAGCAGGG + Intergenic
1090447923 11:126780031-126780053 CCTCCCTTCCAGATACAGCGTGG - Intronic
1090744485 11:129695370-129695392 CCTACCCTCCAGAAGTGTCACGG + Intergenic
1093165781 12:15803477-15803499 GTTCCCCTGCAGAAGCATCATGG - Intronic
1094225272 12:28038608-28038630 CCTTCCCTCCACACCCATCAGGG - Intergenic
1095830951 12:46586052-46586074 CCCCCCATCCAGCTGCAGCAAGG + Intergenic
1097365146 12:58703933-58703955 TCTCTCCTTCAGATACATCAGGG + Intronic
1097376738 12:58852181-58852203 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097377746 12:58859310-58859332 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1101816726 12:108151353-108151375 CCCCCTCTCCACCTGCATCAAGG - Intronic
1101875489 12:108594163-108594185 CCTCACCTCCAGAATCCTCACGG - Intronic
1103049732 12:117768634-117768656 TCTCCCATCCAGATGCTTCCAGG - Intronic
1103763190 12:123265814-123265836 CCTCCCATCCATCTGCATCCTGG - Intronic
1103873171 12:124105970-124105992 CCACCCCTCCGGATCCAGCAGGG - Intronic
1104187860 12:126449627-126449649 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1104492135 12:129203491-129203513 CCTGCCCTCCACATGCTTCCTGG - Intronic
1104536770 12:129624918-129624940 AGTCCCCTCCAGATGCCTCTGGG + Intronic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1109523580 13:63545099-63545121 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1113119121 13:106907534-106907556 CCTCCACTCTTGCTGCATCAAGG - Intergenic
1115151668 14:30293310-30293332 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1116421671 14:44740027-44740049 CCTCTCATCCAGAGGCATCTAGG + Intergenic
1116740335 14:48746746-48746768 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1116752521 14:48904400-48904422 CCTTCCCTCCAGAGGACTCAGGG + Intergenic
1117823512 14:59676052-59676074 CCTCCCCTCATGAAGCATCCAGG - Intronic
1119443567 14:74645974-74645996 CCTCCTCTCCAGAGGCCTGAGGG + Intergenic
1120029633 14:79626313-79626335 CCTCCCCTCCAGATGCCTAGAGG + Intronic
1121310761 14:92933893-92933915 CATCCTCTCCATATGCCTCAGGG - Intronic
1123125468 14:105942912-105942934 CCATCCCTCCGGATCCATCAGGG + Intergenic
1123472111 15:20562931-20562953 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123645892 15:22437422-22437444 CCTTCCCTCCTGCTGCCTCAAGG - Intergenic
1123667209 15:22617291-22617313 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1123732415 15:23157922-23157944 CCTTCCCTCCTGCTGCCTCAAGG + Intergenic
1123750550 15:23355304-23355326 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1124282919 15:28379220-28379242 CCTTCCCTCCTGCTGCCTCAAGG + Intronic
1124299780 15:28532393-28532415 CCTTCCCTCCTGCTGCCTCAAGG - Intronic
1124321049 15:28711858-28711880 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124342360 15:28898104-28898126 CATTCCCTCCAGAGGCACCAGGG - Intronic
1124481448 15:30083497-30083519 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124487903 15:30135593-30135615 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124522147 15:30413697-30413719 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124536518 15:30552521-30552543 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124542992 15:30604570-30604592 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124562952 15:30792013-30792035 CCTCCCCTCCTGCTGCCTCAAGG + Intergenic
1124661514 15:31554143-31554165 CCTGCCCTCCAGCGGCATCCCGG + Intronic
1124755626 15:32402728-32402750 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124762135 15:32455071-32455093 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124776495 15:32593997-32594019 CCTCCCCTCCTGCTGCCTCAAGG + Intronic
1124960347 15:34389210-34389232 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1124976976 15:34535431-34535453 CCTCCCCTCCTGCTGCCTCAAGG - Intronic
1126153880 15:45547348-45547370 CCCCCCCTCCAGATCCGGCAGGG - Intergenic
1127630070 15:60819956-60819978 CCACCCCTGCAGATGCCCCAGGG + Intronic
1128363103 15:66976437-66976459 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1132433890 15:101781508-101781530 CCTCCCCTCCTGCTGCCTCAAGG - Intergenic
1134667134 16:16026963-16026985 CCTGCCCTGCAAATGCAACAAGG - Intronic
1135424239 16:22324441-22324463 CCTCCCCTCCAGCAGCAGCCTGG - Intronic
1135946700 16:26871378-26871400 CCTACCCTCAAGGTGCAACAGGG - Intergenic
1135992868 16:27228496-27228518 CCTCCCCTCCAGATCCATCACGG + Intronic
1135992907 16:27228608-27228630 CCTCCCCTCCAGATCCATCATGG + Intronic
1135992945 16:27228720-27228742 CCTCCCCTCCAGATCCATCATGG + Intronic
1135992961 16:27228776-27228798 CCTCCCCTCCAGATCCATCATGG + Intronic
1135992981 16:27228832-27228854 CCTCCCCTCCAGATGCATCATGG + Intronic
1135993000 16:27228888-27228910 CCTCCCCTACAGATCCATCATGG + Intronic
1137252912 16:46752953-46752975 CTTCCCCTCCAGAGACTTCACGG + Intronic
1137828949 16:51525598-51525620 CCTCCCCTCTAGATCCTTGAAGG + Intergenic
1138943168 16:61814863-61814885 CCTCCACCCCAGTTGGATCATGG - Intronic
1143014129 17:3882774-3882796 CCTCCCCTCCAGCTGCAATGAGG + Intronic
1143186473 17:5013364-5013386 CCACCCATCCAGCTGCATCCAGG - Intronic
1144966632 17:19080585-19080607 GCTAACCTGCAGATGCATCAGGG + Intergenic
1144981286 17:19171472-19171494 GCTAACCTGCAGATGCATCAGGG - Intergenic
1144986938 17:19206767-19206789 GCTAACCTGCAGATGCATCAGGG + Intergenic
1146185635 17:30722502-30722524 CTCCCCCTCCAGAGGCCTCAGGG + Intergenic
1147886517 17:43687965-43687987 CCTCCTCTCCAGAGGCCACAAGG - Intergenic
1148794079 17:50188902-50188924 CCTCACGTCCAGATTCACCAGGG + Exonic
1149243102 17:54673728-54673750 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1150569071 17:66369841-66369863 CCTTCCCTCCACATGCAGAATGG + Intronic
1150571563 17:66391402-66391424 CCTCCCATCCAAATGCCTTATGG + Intronic
1150787402 17:68174164-68174186 TCTCCACTCCAGATGCCTCAGGG + Intergenic
1151224453 17:72638395-72638417 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1151351341 17:73533794-73533816 CCTGCCCTCCAGCTCCTTCAAGG + Intronic
1152291010 17:79440376-79440398 CCTCCCCATCTGATGCACCAGGG + Intronic
1152469038 17:80480854-80480876 TCACCCCTCCAGAGGCAGCATGG - Intergenic
1152581968 17:81169608-81169630 CGCCCCCTCCAGATGCTCCAGGG + Intergenic
1152719271 17:81914922-81914944 CAGCCACTCCAGGTGCATCAGGG - Intronic
1154323761 18:13375205-13375227 CCTCTCCTCCAGATGAGTCCTGG - Intronic
1156533462 18:37840441-37840463 CCTCACATCTGGATGCATCATGG + Intergenic
1159086723 18:63800885-63800907 CTTCCGTTCCTGATGCATCATGG - Exonic
1159122417 18:64186064-64186086 GCTCCAATCTAGATGCATCAGGG - Intergenic
1159279771 18:66270430-66270452 CCATCCCTCCAGATCCAACAGGG - Intergenic
1160034227 18:75286285-75286307 CTTCCCCTCCATCTCCATCAGGG - Exonic
1161007464 19:1943756-1943778 CCCCCTCTCCAGATGCCCCAGGG - Intronic
1162973144 19:14193218-14193240 CTCCCCCTCCAGAGGCCTCAGGG - Intronic
1164173177 19:22745567-22745589 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1164524171 19:29001229-29001251 CCTGCACTCCAGGTGCATTATGG - Intergenic
1164534639 19:29076108-29076130 CCTTCCCTCTAGAGGCTTCAGGG + Intergenic
1165370718 19:35404163-35404185 CCTCACGTACAGCTGCATCATGG + Intergenic
1165396882 19:35569354-35569376 CTCCCCCTCCAGATCCATGAGGG + Intergenic
1165823202 19:38690311-38690333 CCACCCCTCCGGATCCAGCAGGG + Intronic
1166165659 19:40986579-40986601 CCACCCCTCCAGATCCAGCATGG - Intergenic
1166299650 19:41906604-41906626 CCCCACCTCCAGCTGCTTCATGG - Exonic
924973613 2:153855-153877 CCACCCCTCCGGATCCAACAGGG - Intergenic
927317995 2:21708202-21708224 CCTCCCTTCCAGTTGCCTGAAGG - Intergenic
927809933 2:26175232-26175254 CCTCCCCACCAGCTGCAGCCCGG + Intronic
928440109 2:31285137-31285159 CCACCCCTCCGGATCCAGCAGGG + Intergenic
928671898 2:33610985-33611007 CCACCCCTCCGGATCCAGCAGGG - Intergenic
929865083 2:45710785-45710807 CCTCAGCTCCAGAAACATCAGGG - Intronic
930479279 2:51926447-51926469 CCACCCCTCCAGCTTCAACATGG + Intergenic
932196885 2:69792067-69792089 CCTCTCTTCTAGATGCTTCAGGG + Intronic
933910575 2:86937403-86937425 CCTTCCCTCCACATTCATCAGGG + Intronic
934022153 2:87965999-87966021 CCTTCCCTCCACATTCATCAGGG - Intergenic
934672426 2:96223136-96223158 CCACCCCTCCAGATCCAGCAGGG - Intergenic
935748355 2:106209374-106209396 CCACCCCTCCGGATCCAGCAGGG + Intergenic
936077065 2:109408329-109408351 CCTCCCGTCCAGGGCCATCATGG - Intronic
936414531 2:112292631-112292653 CCTTCCCTCCACATTCATCAGGG + Intronic
939096042 2:137834570-137834592 CCTGCCGTCCAGGTGCAGCATGG - Intergenic
940809999 2:158231597-158231619 CCTCTCCTCCAGATACAGCTAGG + Intronic
940819789 2:158339965-158339987 CCTCTCCTCCCAATGCATCCTGG - Intronic
940835165 2:158513334-158513356 CCTCACAGGCAGATGCATCAGGG - Intronic
941157607 2:161998488-161998510 CCTCACCTCCAAAAGCCTCATGG + Intronic
942580686 2:177412964-177412986 CCACCCCTCCAGATCCAGCAGGG - Intronic
943019263 2:182552947-182552969 CCATCCCTCCAGATCCAGCAGGG + Intergenic
946551691 2:220808314-220808336 ACTCCCTTCCAGAGGCTTCAGGG - Intergenic
948211228 2:236194777-236194799 CATCACCTCCATCTGCATCAGGG + Intergenic
948245988 2:236486295-236486317 CCTCCCCTCCAGATCTCACAAGG - Intronic
948406438 2:237723773-237723795 CCTCCCCTCCGGCAGGATCAGGG - Intronic
948694723 2:239727430-239727452 CCTCCCCTCCAGAAGCACAGTGG - Intergenic
1171043536 20:21789011-21789033 CCTCCTCCCCAGGTGCCTCATGG - Intergenic
1172446337 20:34995388-34995410 CTTCCCCTCCAGCTGCACCTTGG - Exonic
1174059385 20:47821764-47821786 CGTCCCCTCCAGATCCCCCAAGG - Intergenic
1175374782 20:58516411-58516433 CCTCCTCTCCAGAGGCAACAGGG + Intergenic
1175626271 20:60490595-60490617 CTTCCCCTCCAGCTGCAGCCAGG + Intergenic
1176272708 20:64244759-64244781 CCTACCCTGCAGCTGCCTCAGGG + Intergenic
1177149328 21:17438868-17438890 CCTCCCTTCCAGATGGATTGAGG + Exonic
1178347254 21:31840976-31840998 CCTCTACTCCAGATAAATCATGG - Intergenic
1179492099 21:41747266-41747288 CCTCCCCTGCCGGTGCACCAGGG + Intronic
1182356160 22:29723108-29723130 CCTCCCCTCATGTTGCATCTGGG - Intronic
1183382316 22:37496375-37496397 CCTCCCCACCCCATGCACCACGG + Intronic
1183606645 22:38870472-38870494 CCTCCCCAAGAGAAGCATCAGGG + Intronic
1183658656 22:39205753-39205775 CCTCCCCTCCAGCTGGAACCTGG - Intergenic
1183741619 22:39671598-39671620 CTTCCCCTCCAACTCCATCAGGG - Intronic
1184346833 22:43918671-43918693 ACTCCCCTCCAGCTCCATCCAGG - Intergenic
1184478915 22:44736111-44736133 CCTCCCGCCCAGATGAACCAAGG + Intronic
1184889786 22:47372581-47372603 CATAACCTCCAGATGCATCATGG + Intergenic
949825295 3:8158512-8158534 CCTTCACTCAAGATGCAGCAAGG + Intergenic
951016250 3:17735764-17735786 CCACCCCTCCAGATCCAGCAGGG - Intronic
952917237 3:38256169-38256191 CCTTCCCTCCAGATATACCATGG - Intergenic
953080027 3:39608320-39608342 CCTGCCATCCAGATGCTTCCTGG + Intergenic
954360568 3:50120596-50120618 CCTCACCTCCAGAGCCCTCACGG + Intergenic
957615317 3:82518977-82518999 GCTCCCCATCAGATGAATCAAGG - Intergenic
960006982 3:112790730-112790752 CCACCCCTCCAGATGCAGCAGGG - Intronic
961332641 3:126152036-126152058 CCTGTCCTCCAGCTGCAGCAAGG + Intronic
961632876 3:128314011-128314033 CCTCCACTCTAGATGCAAGATGG + Intronic
963533675 3:146501766-146501788 CCTCCCCTCCAGATTATGCAGGG - Intergenic
964248509 3:154683221-154683243 ACTCAACTCCAGATGAATCAAGG - Intergenic
967598386 3:191355451-191355473 CCTTCCCTCCAGGTAAATCATGG - Intronic
967968732 3:194984153-194984175 CCCAGCCTCCAGCTGCATCAGGG - Intergenic
969038599 4:4276140-4276162 CTTTCCCTCCAGAGGCATCAGGG - Intronic
969644669 4:8420789-8420811 CCACCCCTCCGGATCCAGCAGGG + Intronic
969645662 4:8427448-8427470 ACCCCCCTCCAGATCCAGCAGGG + Intronic
969699783 4:8761799-8761821 CCTCCCTGCCAGATGCCTCTCGG - Intergenic
974047728 4:56911061-56911083 CCTCCGCTCCAGGTGTTTCAGGG - Exonic
974520768 4:62977424-62977446 CCACCCCTCCAGATCCAGCAGGG + Intergenic
975822530 4:78286461-78286483 CCTCCCCTGCTGATGCGGCACGG + Exonic
976189296 4:82473738-82473760 CCACCCCTCCGGATCCAGCAGGG + Intergenic
977342096 4:95771781-95771803 CCACTCCTCCAGATCCAGCAGGG + Intergenic
977618431 4:99109773-99109795 CCACCACTCCAGATCCAGCAGGG - Intergenic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
980523658 4:133961759-133961781 CCACCCCTCCAGATACGGCAGGG + Intergenic
980728212 4:136792370-136792392 CCACCCCTCCAGATGCACACAGG - Intergenic
980871964 4:138622092-138622114 CCACCCCTCCAGATCCAGCAGGG - Intergenic
983271727 4:165570026-165570048 CCTCCCCTCAAAATCCTTCATGG - Intergenic
983909322 4:173219258-173219280 CTTACCCTCCAGTTGCATCCAGG + Intronic
984280662 4:177666598-177666620 CCACCCCTCCAGACCCAGCAGGG - Intergenic
985590172 5:760440-760462 CATCCCCTCCAGCAGCTTCAGGG + Intronic
986368503 5:7058484-7058506 CCTGTCCTCCAGATGCTACAGGG - Intergenic
986383031 5:7205766-7205788 CCTCCCATCCAGATGTATGTGGG + Intergenic
986418741 5:7554968-7554990 CCTCCCCACAAGATGCTTGAAGG + Intronic
986638187 5:9845209-9845231 CCTCCACCCCACATGCACCAAGG + Intergenic
987129619 5:14848566-14848588 CCACCCCTCCAGATTCGGCAGGG + Intronic
987855132 5:23411346-23411368 CCACCCCTCCGGATCCAGCAGGG + Intergenic
987934899 5:24451245-24451267 CCACCCCTCCAGATCCGGCAGGG - Intergenic
987934910 5:24451312-24451334 CCACCCCTCCGGATCCAGCAGGG - Intergenic
988493569 5:31725993-31726015 TCTTCCCTGCAGATGCATAATGG + Intronic
988602604 5:32653836-32653858 GCTCACCTCCAAATGCAGCATGG - Intergenic
989033946 5:37150081-37150103 CCTCCCCAACAGATTCAGCAGGG + Intronic
990276521 5:54202759-54202781 CCTCCCCTCCAAATACTTTAAGG - Intronic
990564444 5:57015186-57015208 CAACCCCTCCAGATCCAGCAGGG - Intergenic
990891816 5:60658917-60658939 CCACCCCTCCGGATCCAGCAGGG + Intronic
992530947 5:77651110-77651132 CCTGCCCACCAGCTGCATCCAGG - Intergenic
993225650 5:85165372-85165394 CCATCCCTCCAGATCCAGCAGGG + Intergenic
995051932 5:107716833-107716855 CCTTCCCTCCAGAAGCACCAGGG - Intergenic
995125588 5:108574443-108574465 CCATCCCTCCAGATCCAGCAGGG - Intergenic
995785073 5:115819044-115819066 CCACCCCTCCAGATCCGGCAGGG - Intergenic
996939807 5:128990896-128990918 CCACCCCTCCAGATCCAGCAGGG - Intronic
997756083 5:136400586-136400608 CCTCCACTCCAGATGAAATAGGG + Intergenic
998644322 5:144045580-144045602 CCATCCCTCCAGATCCAGCAGGG + Intergenic
998884968 5:146684647-146684669 TCTACCCTCCAGATGCATCGTGG + Intronic
1004236366 6:13878502-13878524 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1004616769 6:17298197-17298219 CCTGTCCTGCAGATGCCTCAAGG + Intergenic
1005099114 6:22150263-22150285 CCTCCCCTCAAGATGCATGAGGG + Intergenic
1005786091 6:29247384-29247406 CCTGCCCTCGAGATGCTACAGGG - Intergenic
1011256514 6:85427297-85427319 CCTCCACTCCAAATAAATCATGG + Intergenic
1011336420 6:86266349-86266371 CACCCCCTCCAGATGCATAGAGG - Intergenic
1012120023 6:95354776-95354798 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1015096544 6:129420941-129420963 CCTCCACTCCAGTTCCATTAGGG + Intronic
1016357660 6:143235606-143235628 CTTCCCCTACAAATGAATCAGGG - Intronic
1016444918 6:144121377-144121399 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1016452758 6:144200299-144200321 CCTCCACTCCAAATAAATCACGG + Intergenic
1017029611 6:150209259-150209281 CCTCACCTGAAGATGGATCATGG - Intronic
1019666579 7:2254926-2254948 CCTCTGCTCCAGCTGCAGCACGG + Exonic
1020218850 7:6218406-6218428 TCTCTCCTCCAGATGGAGCACGG + Intronic
1022117661 7:27276512-27276534 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1022452195 7:30525729-30525751 CCTCCCCTCCTGAAGCCTCAAGG - Intronic
1022499189 7:30871988-30872010 CCTCCACTCCAGCCGCACCAGGG - Intronic
1026346978 7:69482852-69482874 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1026901688 7:74040807-74040829 CCTCCCCTTCACCTGCATCGGGG - Intronic
1027996819 7:85434933-85434955 CCTCCCTCCCAGCTGCTTCATGG - Intergenic
1028013992 7:85684152-85684174 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1029590632 7:101504515-101504537 TCTCCACTCCAGAGGCACCAGGG + Intronic
1030140006 7:106294546-106294568 CCTCCCTTGCAGATACAGCATGG - Intergenic
1030495999 7:110301448-110301470 TCTCTCCTCCTGCTGCATCACGG + Intergenic
1030661156 7:112221080-112221102 CCACCCTTCCAGATCCAGCAGGG + Intronic
1030954044 7:115828847-115828869 CCTCCCCTTCAGATGCCTCTTGG - Intergenic
1031472006 7:122177236-122177258 CCACCCCTCCGGATCCATCAGGG + Intergenic
1033097967 7:138447500-138447522 CCCCACCTCCAAATGTATCAAGG + Intergenic
1034914224 7:155023533-155023555 CCTTCCCTCCAGGTGCAATAGGG + Intergenic
1035420654 7:158726864-158726886 TTTCCCCTCCAGAGGCAGCAAGG + Intergenic
1036744846 8:11399353-11399375 CCTCCCCTGGAGACCCATCAGGG - Intronic
1038686560 8:29724240-29724262 CCTCCCATCCAGGTGCAGCACGG + Intergenic
1039204961 8:35141805-35141827 CCTCCCCTCCAACTCCACCAAGG + Intergenic
1039468584 8:37800039-37800061 CCCTCCCTCAAGATGCATCCTGG - Intronic
1040768446 8:50944260-50944282 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1042055662 8:64763122-64763144 CCACCCCTCCGGATCCAGCAGGG + Intronic
1044324478 8:90844229-90844251 ACACCCCTGCTGATGCATCATGG - Intronic
1044446011 8:92277021-92277043 CCTCCCCTCCTGATACATATAGG + Intergenic
1044690364 8:94871043-94871065 ACTCCCCTCGAGATGCTTCAGGG - Intronic
1045645133 8:104290543-104290565 CCTGTCCTCCAGATGCTACAGGG + Intergenic
1045676642 8:104614893-104614915 CCTGCCATCCAGATGCTTCTTGG + Intronic
1045724790 8:105159721-105159743 GGGCCCCTCCACATGCATCAAGG + Intronic
1045976976 8:108140147-108140169 TCTCCCCTCCTCATGCATAAAGG - Intergenic
1047766120 8:127991524-127991546 CCAGCCCTCCAGGTGCAGCAGGG - Intergenic
1049112505 8:140656434-140656456 CCTGCCCTCCAGAGGTATGAAGG + Intergenic
1049352161 8:142170195-142170217 CATGTCCTCCAGATGCTTCATGG - Intergenic
1049742324 8:144247116-144247138 CCTCCCCTCCTGCTGCAGCGTGG - Intronic
1051339305 9:16096592-16096614 CCTCCCTTCCATATCCATCTAGG - Intergenic
1052034697 9:23667118-23667140 TCTCCCTTCCAGATTCATCAGGG + Intergenic
1052047665 9:23813300-23813322 CCCCCACTCCAGAAGCAGCAGGG - Intronic
1056251508 9:84753212-84753234 CCTCCCCTGAAGAAACATCAAGG - Intronic
1057214206 9:93219103-93219125 CCTCCCCTCCAGGGACATCCAGG - Intronic
1057441153 9:95084744-95084766 CCACCCCTCCAGATGCATCCAGG + Intronic
1061923470 9:133794727-133794749 GGTCCCCTCCAGCTGCATCTGGG - Intronic
1062682425 9:137788909-137788931 CCCCCCATCCAGCTGCATCCTGG - Intronic
1186514112 X:10153355-10153377 CCTCCCCTTCAGATACCTCCTGG - Intergenic
1188535276 X:31190219-31190241 TCTCCTCTTCAGATGCATCTTGG - Intronic
1189152090 X:38719466-38719488 CCAACCCTCCAGATCCAGCAGGG - Intergenic
1190368111 X:49716717-49716739 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1191761764 X:64654505-64654527 CCTGCCCTCGAGATGCTACAGGG + Intergenic
1192233924 X:69284425-69284447 GCTACCCTCCAGCTGCAACAAGG + Intergenic
1192961005 X:76130784-76130806 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1193172379 X:78350328-78350350 CCTCCCCTCTGGATCCAGCAGGG - Intergenic
1194471084 X:94297817-94297839 ACTCAACTCAAGATGCATCAAGG - Intergenic
1195256579 X:103096819-103096841 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1195259083 X:103115357-103115379 CTACCCCTCCAGATCCAGCAGGG - Intergenic
1197999709 X:132420302-132420324 CCACCCCTCCAGATCCGGCAGGG - Intronic
1198862338 X:141084392-141084414 CCACTCCTCCAGATCCAGCAGGG + Intergenic
1198900356 X:141502994-141503016 CCACTCCTCCAGATCCAGCAGGG - Intergenic
1198931817 X:141869963-141869985 CCTCTTTTCCAGATGCTTCAGGG + Intronic
1200415974 Y:2910309-2910331 CCACCCCTCCAGATCCAGCAGGG - Intronic
1201421481 Y:13804589-13804611 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1201906118 Y:19087157-19087179 ACACCCCTCCAGATCCAGCAGGG + Intergenic
1201962275 Y:19694668-19694690 CCACCCCTCCAGATCCAGCAGGG - Intergenic