ID: 1135992984

View in Genome Browser
Species Human (GRCh38)
Location 16:27228837-27228859
Sequence GGGTACCATGATGCATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135992984_1135993000 28 Left 1135992984 16:27228837-27228859 CCTCCAGATGCATCATGGTACCC 0: 1
1: 1
2: 2
3: 5
4: 95
Right 1135993000 16:27228888-27228910 CCTCCCCTACAGATCCATCATGG 0: 1
1: 4
2: 1
3: 28
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135992984 Original CRISPR GGGTACCATGATGCATCTGG AGG (reversed) Intronic
902958051 1:19940219-19940241 GGGTATCATGATGTATCTTCTGG - Intergenic
906991835 1:50747324-50747346 GGGTACAATGATGCAAGGGGTGG - Intronic
911683854 1:100750244-100750266 GGGTGCCATGGGGCATATGGAGG - Intergenic
920677413 1:208047961-208047983 GGGTACAATGAGGCATGGGGAGG + Intronic
921439412 1:215166721-215166743 GGGAACCATGATTTTTCTGGTGG - Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
1069413973 10:68181671-68181693 GGTTCCCATCATGCATCTGTAGG - Intronic
1073334076 10:102692023-102692045 GAGTACAAGGATGCAGCTGGAGG + Intronic
1073513895 10:104060431-104060453 GGTTACTATGAAGCATCTTGGGG + Intronic
1073650815 10:105356047-105356069 GGGTTCAGTGATGCATCTTGCGG + Intergenic
1075986731 10:126794203-126794225 GGATACTTTTATGCATCTGGCGG + Intergenic
1076200430 10:128553401-128553423 GGGTGCCGTGATGCAGCTGCTGG - Intergenic
1076677920 10:132157278-132157300 GGGAAGCATGCTGCAGCTGGTGG - Intronic
1078771889 11:14358989-14359011 GGGTACCGGGAGGCGTCTGGAGG + Exonic
1080150270 11:29044579-29044601 GGGAACCAGGATGGAGCTGGAGG + Intergenic
1084582762 11:70034378-70034400 GGGCACCTTGAGGCATCCGGCGG + Intergenic
1086022403 11:82247281-82247303 GGGTACCATCCTGGAACTGGGGG - Intergenic
1091812571 12:3411709-3411731 GGGCCCCATGATGAAACTGGTGG + Intronic
1093165778 12:15803472-15803494 AAGTACCATGATGCTTCTGCAGG + Intronic
1100682427 12:96941807-96941829 TGGAACCATAATGAATCTGGAGG - Intronic
1103706772 12:122879100-122879122 GGGTACCCTGTTCCCTCTGGAGG - Intronic
1108949937 13:56079094-56079116 GGATAACATGATGTTTCTGGGGG + Intergenic
1113948193 13:114056627-114056649 GGGTCCCGTGAGGCTTCTGGTGG + Intronic
1115656003 14:35444413-35444435 GGCCACCATGATGGAACTGGTGG - Intergenic
1123125470 14:105942917-105942939 GGATACCCTGATGGATCCGGAGG - Intergenic
1128255246 15:66191421-66191443 TGGCACCAGGATGCCTCTGGGGG + Intronic
1129040271 15:72679963-72679985 GGTTACCAGGATGCTTCTGGCGG - Intronic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1136545741 16:30953696-30953718 GGGTACCATGATGGCTGTGGAGG - Exonic
1143039151 17:4019754-4019776 GGGCATCATGAGCCATCTGGAGG + Exonic
1146688743 17:34858638-34858660 GGTTACCAGGCTGCATTTGGGGG - Intergenic
1151948515 17:77332675-77332697 GGGGACTGTGATGCACCTGGAGG - Intronic
1155986527 18:32236267-32236289 GGGTCCCATCATGCCTCAGGAGG + Intronic
1157338944 18:46761983-46762005 CTGTACTATGATGCATCAGGTGG - Intergenic
1159835741 18:73333119-73333141 GGATCCAATGATGCTTCTGGGGG - Intergenic
1160426040 18:78779996-78780018 GGTCACCATGAGCCATCTGGGGG - Intergenic
1164230895 19:23287273-23287295 GTGAAACATGAGGCATCTGGAGG + Intergenic
1165991497 19:39817679-39817701 GGATACCATGTTGCATTTGTTGG - Intergenic
1166165656 19:40986574-40986596 GGACACCATGCTGGATCTGGAGG + Intergenic
1166299647 19:41906599-41906621 GGAGACCATGAAGCAGCTGGAGG + Exonic
1166768924 19:45268919-45268941 GGCTTCCATGATTCACCTGGAGG + Intronic
932218702 2:69983819-69983841 CAGTACCATGATGGAACTGGGGG - Intergenic
932557985 2:72842453-72842475 GGGGAACAGGATGCAGCTGGGGG - Intergenic
934977176 2:98811114-98811136 GGGAAACACGATGAATCTGGTGG + Intronic
1172809016 20:37633748-37633770 GGGTACCAGGCTCCTTCTGGAGG - Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1176000266 20:62828492-62828514 GGGCACCATGATGTGCCTGGTGG + Intronic
1177232012 21:18334207-18334229 GGGTTTCATGATGCATATGATGG + Intronic
1184889787 22:47372586-47372608 AGCATCCATGATGCATCTGGAGG - Intergenic
960006979 3:112790725-112790747 GGACACCCTGCTGCATCTGGAGG + Intronic
960489467 3:118296674-118296696 GGGTACCATGATACCTTTAGAGG - Intergenic
961081700 3:124033503-124033525 GGGTACCATGGGGGAGCTGGCGG + Intergenic
961575626 3:127833679-127833701 GGGCACCCTTATGCATCTGTGGG - Intergenic
962084503 3:132175881-132175903 AGTTACCATGATGCAGGTGGAGG + Intronic
962394887 3:135006919-135006941 GGGTACCATGTTTCAGCTGTCGG - Intronic
968665506 4:1819754-1819776 GGGCACAAAGATGCATTTGGAGG - Intronic
972926510 4:44015480-44015502 GGGTACCAATATGCATTAGGTGG - Intergenic
981721160 4:147802870-147802892 GGGCACCATGTTTCATTTGGAGG - Intronic
982623961 4:157741491-157741513 GGGGACCATGATGCATGATGGGG - Intergenic
986154199 5:5157517-5157539 TAGTGACATGATGCATCTGGTGG + Intronic
987776786 5:22377000-22377022 AGGTCCCATGATGCCTCTGGTGG - Intronic
988489934 5:31697707-31697729 TGGTACCATGGAGCAGCTGGAGG - Intronic
989215765 5:38902834-38902856 GGGTATTCAGATGCATCTGGAGG - Intronic
990355822 5:54965185-54965207 GAGTACAATGAAGCATGTGGAGG - Intergenic
990506544 5:56451006-56451028 TGGTACCATTGTGCAGCTGGTGG - Intergenic
998884970 5:146684652-146684674 AGTTTCCACGATGCATCTGGAGG - Intronic
999602002 5:153277227-153277249 GTGTGCCATGCTGTATCTGGTGG + Intergenic
1001766408 5:174251030-174251052 GTGTATAATGATGCATCTGTTGG + Intergenic
1002294543 5:178223058-178223080 GGGTTCCATGTTACATCTGAAGG + Intronic
1005055835 6:21728122-21728144 GGGGACTATGAGGCACCTGGGGG - Intergenic
1006446685 6:34083706-34083728 GGGTCCCAGGAGGCAGCTGGTGG + Intronic
1010664157 6:78607327-78607349 GGGGACCATCAATCATCTGGGGG - Intergenic
1011987338 6:93465259-93465281 GGATGCCATGATGCTTCTGTGGG + Intergenic
1013272150 6:108555416-108555438 TGTTACGATGATGCATTTGGAGG - Intergenic
1016642527 6:146365771-146365793 GGTTACCATTTTGCATATGGTGG - Intronic
1017468186 6:154714537-154714559 GGGCCCCATGATGCAACTGATGG + Intergenic
1025201996 7:56968239-56968261 GGGTACCAGGCTCCATGTGGGGG - Intergenic
1025669951 7:63608689-63608711 GGGTACCAGGCTCCATGTGGGGG + Intergenic
1025875103 7:65474167-65474189 GGGAAACATTATTCATCTGGAGG + Intergenic
1033705186 7:143879776-143879798 GGGTACAATGGGGTATCTGGGGG - Intronic
1046860678 8:119087771-119087793 GTATACCATGATGAATCTAGAGG + Intronic
1047980577 8:130176999-130177021 GGGTACCATGGAGCATCAAGAGG - Intronic
1049352160 8:142170190-142170212 CGGATCCATGAAGCATCTGGAGG + Intergenic
1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG + Intronic
1053295648 9:36911231-36911253 GAGTACCATGGTGCCCCTGGTGG - Intronic
1055666934 9:78562389-78562411 GTGTACCATGAAGCATCATGAGG + Intergenic
1057301522 9:93888207-93888229 GGCTAGCATGATCCATGTGGTGG + Intergenic
1057931971 9:99201488-99201510 GGGGACAATGATGCATCCTGTGG + Intergenic
1060674072 9:125496570-125496592 TGGTTCCATGCTGCTTCTGGAGG - Intronic
1062013676 9:134280578-134280600 AGGTACCCTGATGCAGATGGAGG - Intergenic
1187867008 X:23732158-23732180 GGATTGCATGTTGCATCTGGTGG - Intronic
1188512866 X:30955795-30955817 GGGACCCATGATGCAACTCGGGG - Intronic
1191250303 X:58257014-58257036 GGGGACGTTGATGCATCTAGGGG + Intergenic
1192528477 X:71867691-71867713 GGGGACCATCACGCATGTGGTGG - Intergenic
1193781480 X:85707760-85707782 GGGTACATGGATGCAACTGGAGG + Intergenic
1196099186 X:111830077-111830099 GGTTACAATGATGCAAGTGGTGG - Intronic
1196630340 X:117931391-117931413 GGGTATCATGCTTCAGCTGGTGG - Intronic