ID: 1135993003

View in Genome Browser
Species Human (GRCh38)
Location 16:27228893-27228915
Sequence GGTTGCCATGATGGATCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135993003 Original CRISPR GGTTGCCATGATGGATCTGT AGG (reversed) Intronic
901123533 1:6913431-6913453 CGTTACCATGATGGCTCTGCTGG - Intronic
907482417 1:54754402-54754424 GCTGGGCATGAAGGATCTGTGGG + Intergenic
908406083 1:63815684-63815706 TGTGGTGATGATGGATCTGTGGG + Intronic
918148689 1:181780248-181780270 GGTTGCTGTGAGGGATCTGAGGG + Intronic
919218817 1:194598420-194598442 TGTTGCCCTGATGGAGCAGTAGG + Intergenic
921661293 1:217806240-217806262 GGTCACCCTGATGGCTCTGTGGG + Intronic
922787012 1:228287854-228287876 GGGTGCCATGCTGGAGCTGGTGG + Exonic
1066521480 10:36224833-36224855 GGCTGCCATGCTGGATTTGAAGG - Intergenic
1067794113 10:49308294-49308316 GGGTGCCATGATGGCAGTGTTGG - Intronic
1069413973 10:68181671-68181693 GGTTCCCATCATGCATCTGTAGG - Intronic
1070495475 10:77017498-77017520 GATTGCCATGATTGAGTTGTGGG - Intronic
1071127970 10:82357647-82357669 GGCCCCCATGATGGAACTGTTGG - Intronic
1074541087 10:114365650-114365672 AGTTACCATGATGGATCTAAGGG + Intronic
1076287662 10:129315824-129315846 AGTTGCCATGTGGAATCTGTGGG - Intergenic
1076416037 10:130289684-130289706 GGTTTTCATGTTGGATTTGTTGG + Intergenic
1077144072 11:1037036-1037058 GGTGGCCGGGATGGACCTGTTGG + Intergenic
1082748115 11:56989563-56989585 GGTGGCCATGATGTAGATGTAGG - Exonic
1082751106 11:57018740-57018762 GGTGGCCATGATGTAGATGTAGG - Intergenic
1084648640 11:70475179-70475201 GGTTTCTATGAAGGGTCTGTGGG - Intronic
1086174783 11:83878127-83878149 GGGTGCTATTATGGATATGTAGG - Intronic
1086231921 11:84579614-84579636 GGTTGGCAAGGTGAATCTGTGGG + Intronic
1086494169 11:87385243-87385265 GCCTGCCATCAGGGATCTGTAGG + Intergenic
1087286193 11:96267481-96267503 GGTTGCCTTGAGGGAACTGTAGG - Intronic
1090365047 11:126198526-126198548 GGATGCCAAGATGGAGCTCTGGG + Intergenic
1090748555 11:129726602-129726624 GGTTGGCATGGTAGAACTGTGGG - Intergenic
1091027021 11:132150459-132150481 GGTTACCATTATGGATCAGCAGG + Intronic
1091074571 11:132603227-132603249 GATTCCTATGATGGATCAGTAGG - Intronic
1098322419 12:69259033-69259055 GGTCGCCCATATGGATCTGTTGG - Exonic
1103279598 12:119745542-119745564 GGTTGCCATTTTCCATCTGTCGG - Intronic
1104966533 12:132510990-132511012 GCTGGGCATGAAGGATCTGTGGG + Intronic
1107851189 13:44575384-44575406 GGTGCCCATGATGAATCTGATGG + Exonic
1112105264 13:96232875-96232897 TGTTCCCAGGATGGATGTGTTGG + Intronic
1112576705 13:100642719-100642741 TGCTGCCATGATGGAGCTGCTGG + Intronic
1122298995 14:100721433-100721455 GGGTGCAATGATGGATTTGAAGG - Intergenic
1125471274 15:40006497-40006519 TGATACCATGTTGGATCTGTTGG + Intronic
1125690929 15:41595661-41595683 CGTTGCCATCATGGTTTTGTTGG + Intergenic
1127818593 15:62635042-62635064 GGATGGCAGGATGGTTCTGTGGG + Intronic
1133377434 16:5299006-5299028 GTTTGGCATGATGGTTGTGTGGG - Intergenic
1135992871 16:27228501-27228523 GGGTGCCGTGATGGATCTGGAGG - Intronic
1135992891 16:27228557-27228579 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992910 16:27228613-27228635 GGGTACCATGATGGATCTGGAGG - Intronic
1135992929 16:27228669-27228691 GGGTGCTGTGATGGATCTGGAGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1135993003 16:27228893-27228915 GGTTGCCATGATGGATCTGTAGG - Intronic
1144782450 17:17814842-17814864 GGTGGCCATGCTGGAACTGATGG + Exonic
1154567270 18:15914477-15914499 GTTTGGCATGATGGTTGTGTGGG + Intergenic
1154591547 18:16246372-16246394 GTTTGGCATGATGGTTGTGTGGG + Intergenic
1154605116 18:16431996-16432018 GTTTGGCATGATGGTTGTGTGGG + Intergenic
1155898111 18:31354375-31354397 GGTTCCCCTGCTGGCTCTGTGGG + Exonic
1158480270 18:57815686-57815708 GGTTGCCATCTTGGATCTGAGGG + Intergenic
1159369441 18:67512724-67512746 TGGTGCCATGATGGATGTGTGGG - Exonic
1161948464 19:7453745-7453767 GGGTGCCATCTTGGATCAGTGGG + Intronic
1161948518 19:7454041-7454063 GGGTGCCATCTTGGATCAGTGGG + Intronic
1163694946 19:18759428-18759450 GGTTCTCATGATGCATCTCTGGG + Intronic
926312598 2:11685400-11685422 GGCAGACATGATGGACCTGTTGG + Intronic
926872567 2:17439230-17439252 GGTTGCCTTCATGTCTCTGTGGG - Intergenic
934034934 2:88081222-88081244 GATTGTGATGATGGTTCTGTGGG + Intronic
937729887 2:125216168-125216190 GCTTGAGATGATGGATATGTTGG - Intergenic
938186443 2:129236324-129236346 GGTTACCATGATGGGCTTGTGGG + Intergenic
945253908 2:207788091-207788113 GGTTCCCATCATGTTTCTGTTGG - Intergenic
945295260 2:208164129-208164151 GATTACCATGATTGATATGTTGG - Intergenic
948336718 2:237214078-237214100 GGTCCACATGATGGAACTGTGGG + Intergenic
1169567400 20:6870075-6870097 GGTTGCAAAGATGATTCTGTAGG - Intergenic
1172654000 20:36525844-36525866 GGTTGGCATCAGGGTTCTGTGGG - Exonic
1174443037 20:50571196-50571218 GGTTGTCACAGTGGATCTGTGGG - Intronic
1185260004 22:49856437-49856459 GGTTGCCCTGAAGGGTCTGGGGG + Intronic
952762428 3:36926483-36926505 GATTGCCATGAGGGATCGATTGG - Intronic
953220653 3:40969082-40969104 AGTTGCCATCATGGACCTGGTGG + Intergenic
955826970 3:62957709-62957731 GGATTCTATTATGGATCTGTTGG + Intergenic
956149372 3:66224973-66224995 GGTTCCCATGGTGGCTTTGTGGG + Intronic
959017398 3:101150734-101150756 GGCTGCCAGGAGGGACCTGTGGG + Intergenic
961306299 3:125960604-125960626 GCTGGGCATGAAGGATCTGTGGG + Intergenic
961411347 3:126723068-126723090 GGGTGCCAAGATGGTTCAGTGGG - Intronic
969604602 4:8196270-8196292 GGTTGTGTTGATGGATGTGTTGG + Intronic
977938753 4:102835010-102835032 GGATACCCTGATGGCTCTGTGGG + Intronic
984790256 4:183608623-183608645 GGTTCCTATGAGGGGTCTGTTGG - Intergenic
989166106 5:38435009-38435031 GATTGTCATGATGGGTCTCTAGG + Intronic
990863091 5:60350279-60350301 GGTTGCCAGGAGTCATCTGTGGG - Intronic
991710442 5:69403448-69403470 AGTGGACATGATGAATCTGTTGG - Intronic
1003168941 6:3705151-3705173 GTTTGCCAAGATGGATCACTAGG + Intergenic
1008060271 6:46989704-46989726 GGTTGGCATAATGTAGCTGTTGG + Intergenic
1011987338 6:93465259-93465281 GGATGCCATGATGCTTCTGTGGG + Intergenic
1013366628 6:109442203-109442225 AGTCACCATGATGGATCTGCAGG - Exonic
1014022536 6:116607799-116607821 GGTTGCTTTGTTGCATCTGTGGG - Intergenic
1016369260 6:143355197-143355219 AGTTGCTATGATGGGTCAGTTGG - Intergenic
1016617811 6:146073193-146073215 GGGAGAAATGATGGATCTGTAGG + Intronic
1019693548 7:2431757-2431779 GGTGGCCCTGATGAAGCTGTAGG + Intronic
1026634778 7:72072052-72072074 GGTTTCCATAATGTATATGTTGG - Intronic
1027557909 7:79688546-79688568 GGTTACCATAAAGGATCAGTGGG + Intergenic
1036458384 8:8929866-8929888 GGTTGGAAGGATGGATCTGAGGG - Intergenic
1037100208 8:15033855-15033877 GGTTGGTCTGATGGGTCTGTGGG - Intronic
1037204889 8:16304890-16304912 AGTTGCCAAGATTAATCTGTAGG - Intronic
1039327919 8:36505065-36505087 GGTTTCCATTATGGAACTCTGGG - Intergenic
1041145938 8:54875754-54875776 GGTTGCCATGCTGGCTCAGGTGG - Intergenic
1041952066 8:63514929-63514951 GATTGCAATGATGGATAAGTAGG - Intergenic
1042040452 8:64583479-64583501 GGGAGCTGTGATGGATCTGTTGG + Exonic
1048849833 8:138634426-138634448 GCTACCCATGATGGATATGTGGG + Intronic
1056977005 9:91267084-91267106 AGTTTCAATGATGCATCTGTAGG - Intronic
1057806707 9:98224799-98224821 GGTTCCCATTCTGGATCCGTGGG + Intronic
1060861242 9:126956556-126956578 GGCTGCCATGCTTCATCTGTAGG + Intronic
1189590146 X:42502185-42502207 GGGTGCCACGGTGGATCTGAAGG + Intergenic
1190333116 X:49247888-49247910 GGGAGCCATTAGGGATCTGTGGG + Intronic
1192543371 X:71993534-71993556 GGTAGACATGATGGTCCTGTAGG + Intergenic
1200226818 X:154422127-154422149 GGTTGCCCAGATGGAGCTGGGGG + Intergenic
1201582023 Y:15519486-15519508 GGATACCCTGCTGGATCTGTGGG + Intergenic