ID: 1135994061

View in Genome Browser
Species Human (GRCh38)
Location 16:27235276-27235298
Sequence CAATGCCACCGTAGATAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135994061_1135994068 8 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994068 16:27235307-27235329 TAAACAGACCAAAAAAAGGGGGG 0: 1
1: 0
2: 4
3: 35
4: 608
1135994061_1135994067 7 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994067 16:27235306-27235328 ATAAACAGACCAAAAAAAGGGGG 0: 1
1: 0
2: 3
3: 75
4: 863
1135994061_1135994066 6 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994066 16:27235305-27235327 AATAAACAGACCAAAAAAAGGGG 0: 1
1: 0
2: 8
3: 187
4: 5181
1135994061_1135994065 5 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994065 16:27235304-27235326 AAATAAACAGACCAAAAAAAGGG 0: 1
1: 2
2: 21
3: 313
4: 3456
1135994061_1135994070 16 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994070 16:27235315-27235337 CCAAAAAAAGGGGGGTGACCAGG 0: 1
1: 0
2: 1
3: 13
4: 158
1135994061_1135994071 17 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994071 16:27235316-27235338 CAAAAAAAGGGGGGTGACCAGGG 0: 1
1: 0
2: 0
3: 16
4: 225
1135994061_1135994064 4 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994064 16:27235303-27235325 GAAATAAACAGACCAAAAAAAGG 0: 1
1: 0
2: 11
3: 107
4: 1546
1135994061_1135994073 19 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994073 16:27235318-27235340 AAAAAAGGGGGGTGACCAGGGGG 0: 1
1: 0
2: 1
3: 35
4: 270
1135994061_1135994072 18 Left 1135994061 16:27235276-27235298 CCAACTTATCTACGGTGGCATTG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1135994072 16:27235317-27235339 AAAAAAAGGGGGGTGACCAGGGG 0: 1
1: 0
2: 1
3: 25
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135994061 Original CRISPR CAATGCCACCGTAGATAAGT TGG (reversed) Exonic
904733522 1:32612756-32612778 AAAAGCCACAGTAGATAAGTAGG + Intronic
1069863934 10:71488766-71488788 CAATGCCACTAGGGATAAGTAGG - Intronic
1081002013 11:37686308-37686330 CAATGACACAATAAATAAGTGGG + Intergenic
1082661238 11:55913833-55913855 AATTGCAACCGCAGATAAGTGGG + Exonic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1090705717 11:129334510-129334532 CAATGCCACAGTTGAGAGGTGGG + Intergenic
1095979893 12:47966111-47966133 CACTGCCACCGTGTAGAAGTTGG - Exonic
1099092803 12:78334837-78334859 GAATTGCATCGTAGATAAGTGGG - Intergenic
1099614286 12:84914477-84914499 CAATGCCAATGAAGAGAAGTAGG + Intergenic
1101225458 12:102683782-102683804 CAATCCCACGGAAGATCAGTGGG + Intergenic
1105229620 13:18479206-18479228 CAATGCCACCGAAGAAATGGGGG + Intergenic
1111849632 13:93556007-93556029 GAATGCCACCTTAGATATGGAGG - Intronic
1112164302 13:96901237-96901259 CAATGCCAGAATAGATCAGTAGG + Intergenic
1126504633 15:49390487-49390509 CAATGCCACTTTGGATAATTGGG - Intronic
1127524072 15:59774864-59774886 CAATGCAGCCATAGACAAGTAGG + Intergenic
1133330751 16:4971909-4971931 CAATGCCACCGTCTCTATGTAGG - Intronic
1135994061 16:27235276-27235298 CAATGCCACCGTAGATAAGTTGG - Exonic
1144496023 17:15745445-15745467 CAATGCCACAGTGAATAAGGGGG + Intronic
1157186607 18:45546094-45546116 CAATGACACAGTGGATATGTGGG - Intronic
1160490510 18:79333761-79333783 CATTGCGGCCGTAGCTAAGTTGG + Intronic
931032371 2:58192687-58192709 AAATTCCACCGTAGATAATGAGG - Intronic
940363281 2:152818675-152818697 CAATGTCACCTTAGAAGAGTGGG - Intergenic
943783568 2:191850966-191850988 TAATGCAACAGTAGATAACTGGG + Intergenic
944449251 2:199824263-199824285 CAATGCTACGGAAGAAAAGTTGG - Intronic
1176773609 21:13107565-13107587 CAATGCCACCGAAGAAATGGGGG + Intergenic
1177456698 21:21349065-21349087 CAAAGCAAACGTAGACAAGTGGG + Intronic
1178298320 21:31429524-31429546 CCCTGCCACTGTAGCTAAGTGGG + Intronic
1180735166 22:18011167-18011189 CAATGCCATCATTGACAAGTAGG + Intronic
950321418 3:12058122-12058144 TAAGGACACTGTAGATAAGTAGG + Intronic
956688389 3:71853682-71853704 AAATGCCACCGAAGATCAATAGG - Intergenic
972176291 4:36410529-36410551 TAATGCCACAGTAGGTAATTAGG - Intergenic
973790508 4:54374027-54374049 CAACGCCACCGCAGATGAGAGGG + Intergenic
976032924 4:80779408-80779430 CCATGCCACAGTAGCAAAGTAGG - Intronic
977338797 4:95730939-95730961 GAATGCCACCTTAGTAAAGTAGG - Intergenic
980760639 4:137229527-137229549 CACTGCCACAGTAAATATGTAGG - Intergenic
999713321 5:154338223-154338245 CTATGCCACCGTGGAGAAGATGG - Intronic
1043719293 8:83526356-83526378 CAAAGCCACAGTAGTTAATTGGG + Intergenic
1049121033 8:140737958-140737980 TAATGCCCCCATAGATAACTAGG - Intronic
1203780921 EBV:100426-100448 AGATGCCTCCGTAGATGAGTCGG + Intergenic