ID: 1135994206

View in Genome Browser
Species Human (GRCh38)
Location 16:27236080-27236102
Sequence GGACCTGGATGGTGGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 193}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135994206_1135994213 -7 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994213 16:27236096-27236118 CAGGTCCATCAGTCTGAGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 163
1135994206_1135994218 14 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994218 16:27236117-27236139 GGGGCACCCACACTATTGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 87
1135994206_1135994220 16 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994220 16:27236119-27236141 GGCACCCACACTATTGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 44
1135994206_1135994223 27 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994223 16:27236130-27236152 TATTGCCGGGGGCTCAGCTGAGG 0: 1
1: 0
2: 1
3: 7
4: 105
1135994206_1135994217 13 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994217 16:27236116-27236138 GGGGGCACCCACACTATTGCCGG 0: 1
1: 1
2: 1
3: 10
4: 81
1135994206_1135994212 -8 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994212 16:27236095-27236117 CCAGGTCCATCAGTCTGAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 136
1135994206_1135994224 30 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994224 16:27236133-27236155 TGCCGGGGGCTCAGCTGAGGAGG 0: 1
1: 0
2: 0
3: 21
4: 316
1135994206_1135994214 -6 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994214 16:27236097-27236119 AGGTCCATCAGTCTGAGGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 123
1135994206_1135994215 -5 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994215 16:27236098-27236120 GGTCCATCAGTCTGAGGAGGGGG 0: 1
1: 0
2: 1
3: 10
4: 146
1135994206_1135994219 15 Left 1135994206 16:27236080-27236102 CCCAGGGGCCACCATCCAGGTCC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1135994219 16:27236118-27236140 GGGCACCCACACTATTGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135994206 Original CRISPR GGACCTGGATGGTGGCCCCT GGG (reversed) Intronic
900570766 1:3357196-3357218 GGACCTGGCTCTTGGCCCCCAGG + Intronic
900598612 1:3493626-3493648 GCACCTGGACTGTGCCCCCTGGG - Intronic
900607328 1:3529713-3529735 GGACGTGGGTGGTGGTCGCTGGG - Intronic
901216106 1:7556218-7556240 GCAGCTAGATGGTGGCCCTTGGG + Intronic
901488126 1:9579567-9579589 GCTCCTGGAGGGTGGCCCCCGGG - Intronic
902990031 1:20180848-20180870 GGACCCAGATGGTGGCGTCTAGG - Intergenic
903294005 1:22332241-22332263 GGGCCTGGCTGGGGGCCCTTGGG - Intergenic
903856698 1:26342133-26342155 GGGCCTGCATGCTGGCTCCTGGG + Intronic
905217320 1:36418080-36418102 GCTGCTGGATGGTGACCCCTGGG - Exonic
905387803 1:37616247-37616269 GGACATGGAGGGTGACCTCTGGG + Intronic
905420649 1:37841249-37841271 TGACCAGGATCATGGCCCCTTGG - Intronic
906525090 1:46489221-46489243 GCACCTGGATGTTGGCCTCTGGG - Intergenic
909699011 1:78499561-78499583 GGACCTGGTTGATAGCCCCTGGG + Intronic
915107287 1:153542394-153542416 TGACCTGGGTGGAGGCCCCAGGG + Intergenic
916220750 1:162442846-162442868 AGTCCTGGTTGGTGTCCCCTTGG + Intergenic
917135393 1:171784138-171784160 GGTCCTGGCTGTTGGCCACTTGG - Exonic
917927326 1:179800183-179800205 GAACCTGGCTGTGGGCCCCTTGG - Intronic
919464141 1:197911281-197911303 GGACCTGGAAGCTGGGCCTTGGG - Intergenic
1062806102 10:420526-420548 GGACTTGGATGGTAGCGTCTGGG + Intronic
1063370173 10:5516084-5516106 AGACCTCCATGCTGGCCCCTGGG - Intergenic
1064148441 10:12843391-12843413 GGAGCTGGATGATGACTCCTGGG - Intergenic
1065299906 10:24311855-24311877 GGACTTGGCAGGTGGCACCTGGG + Intronic
1065637171 10:27744235-27744257 GGACCTGGGTCCTGGCGCCTTGG - Intronic
1066301895 10:34104681-34104703 GGACCGGAATGGGGGCCCCTTGG + Intergenic
1067717635 10:48701716-48701738 GAACTTGGCTGGTGGCCCCGTGG + Intronic
1071061063 10:81571057-81571079 GGAAGTGGATTGTGGACCCTGGG + Intergenic
1073109841 10:101055141-101055163 GGTCCAGGGTGGTGGCTCCTGGG + Intergenic
1073400805 10:103255897-103255919 TGACCTGTATGGTGGCTCCCTGG - Intergenic
1073400813 10:103255955-103255977 TGACCTGTATGGTGGCTCCCTGG - Intergenic
1075476513 10:122739814-122739836 GGAACCAGATGATGGCCCCTGGG + Intergenic
1075726088 10:124611622-124611644 GGACCTGGACGGGGGCCACAGGG - Intronic
1076482873 10:130796360-130796382 GGCCCTGGGTGCTGGCACCTGGG - Intergenic
1076616714 10:131759865-131759887 TTCCCTGGCTGGTGGCCCCTAGG + Intergenic
1076843667 10:133058542-133058564 TTGCCTGGGTGGTGGCCCCTGGG + Intergenic
1076881021 10:133239296-133239318 GGACAGGGATGGGTGCCCCTGGG + Intronic
1080645141 11:34182645-34182667 GGACCTGAAGGGTGACCCCTGGG - Intronic
1081783382 11:45729080-45729102 GCAGCTGGGTGGTGCCCCCTTGG - Intergenic
1083147941 11:60772741-60772763 GCACGGGGATGGTGACCCCTGGG + Intronic
1083262917 11:61532825-61532847 GGCCCAGCATGGTGGCCACTCGG - Intronic
1083920391 11:65779115-65779137 AGCCCTGGATGGGGGCCCCCGGG - Exonic
1084729215 11:71062477-71062499 GGACATGAAAGCTGGCCCCTGGG + Intronic
1088912097 11:114199404-114199426 GGACATGGATGCTGGGCCCCGGG + Intronic
1089376677 11:117999692-117999714 GGACCAGGAGGAGGGCCCCTGGG + Exonic
1089772939 11:120816333-120816355 GGACCTGGCTGGAAGGCCCTTGG - Intronic
1089970586 11:122689931-122689953 GGTCCTGGAGGGTGGCGCCAGGG - Intronic
1096137502 12:49214782-49214804 GGGCCAGGATATTGGCCCCTAGG - Intronic
1096609518 12:52791661-52791683 GGTCATGGATGCTGGCACCTGGG - Intronic
1102020510 12:109678991-109679013 GGACCTGGAAGAAGACCCCTTGG - Intergenic
1102460537 12:113097070-113097092 GGACCTGCCTGGTGGCAGCTGGG + Exonic
1103340678 12:120219651-120219673 AGGGCTGGCTGGTGGCCCCTGGG + Intronic
1103724706 12:122991848-122991870 GGTCCTGGAGGGCGGCCCCCTGG - Intronic
1103913195 12:124363166-124363188 TGACCAGGCTGGTGGTCCCTTGG - Intronic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1104252547 12:127109227-127109249 GCATCTGGATATTGGCCCCTAGG - Intergenic
1104596597 12:130124492-130124514 GGATCTGGATGGTGTAGCCTTGG + Intergenic
1104639946 12:130461013-130461035 GGCCCTATCTGGTGGCCCCTTGG - Intronic
1104748774 12:131225426-131225448 GGACCTGGGTGGGTGTCCCTGGG - Intergenic
1104784349 12:131440138-131440160 GGACCTGGGTGGGTGTCCCTGGG + Intergenic
1105340361 13:19517519-19517541 GGAACTAGATGGTGGTCTCTGGG - Intronic
1106076584 13:26465838-26465860 GGAGCTGGCTGGTGGCCTCTGGG + Intergenic
1108178602 13:47819387-47819409 GGACCTGGTGGGAGGTCCCTTGG + Intergenic
1108915604 13:55606503-55606525 GGGCCTGGCTGGTAACCCCTGGG - Intergenic
1112937836 13:104823420-104823442 AGAGCTGGATCGTGGCTCCTTGG - Intergenic
1113705572 13:112430599-112430621 GGACTGGGGTGATGGCCCCTGGG + Intronic
1113952729 13:114080712-114080734 TGCCCTGGGAGGTGGCCCCTGGG - Intronic
1116862659 14:50007124-50007146 GGGGCTTGAGGGTGGCCCCTGGG - Exonic
1116866214 14:50033755-50033777 GGAGCCGGATGGTGGCAGCTTGG + Intergenic
1119665806 14:76484290-76484312 GGGACTGCCTGGTGGCCCCTGGG + Intronic
1122629048 14:103099099-103099121 GCACCTGGGTGGGGGGCCCTGGG + Intergenic
1122973464 14:105161692-105161714 AGTCCTGGAGGCTGGCCCCTAGG - Intronic
1124372201 15:29110297-29110319 GGTGCTGTATGGTGTCCCCTGGG + Intronic
1124668535 15:31616193-31616215 GGACCTGGGAGCTGGCACCTTGG + Intronic
1125930485 15:43596156-43596178 GAATCTTCATGGTGGCCCCTGGG - Intronic
1125943653 15:43695988-43696010 GAATCTTCATGGTGGCCCCTGGG - Intronic
1126795669 15:52258893-52258915 TGAGCTGGACGGTGGCCCCCAGG - Intronic
1128719761 15:69939808-69939830 GGACCTGCAGGATGGCCCCTGGG + Intergenic
1130012927 15:80166058-80166080 GGAACTGGATGGTGGCCCATAGG - Intronic
1131159930 15:90099070-90099092 GGACCTGGGTGGTGGCGCTGGGG - Intronic
1132744382 16:1430629-1430651 GGCCCTGGCTGGGGGTCCCTGGG + Intergenic
1132980685 16:2737427-2737449 GGGCCTGGCTGGGGGTCCCTAGG - Intergenic
1134218167 16:12332643-12332665 GGACCTGGAAGGTGGGCCTAAGG - Intronic
1134291370 16:12904485-12904507 GGACCAGGAAGTTGGGCCCTTGG - Intronic
1135994206 16:27236080-27236102 GGACCTGGATGGTGGCCCCTGGG - Intronic
1137848733 16:51716821-51716843 TGACTTGGATGGAGACCCCTTGG - Intergenic
1140883859 16:79225420-79225442 TGACCTGGATGGTGTTGCCTAGG - Intergenic
1142261614 16:89045091-89045113 CGCCCTGCATGGAGGCCCCTTGG - Intergenic
1142339088 16:89508766-89508788 GGCCCTGGATCGTGGGCGCTGGG + Intronic
1142811260 17:2396678-2396700 GAACCAGAATGGTGGCGCCTGGG - Intronic
1142901414 17:3014210-3014232 AGACCTGGATGGTCGAGCCTAGG + Intronic
1144575381 17:16426484-16426506 GGACCCGGATGGTTGCCACGAGG - Intronic
1145304462 17:21665710-21665732 GGCACTGGATGGAGACCCCTGGG + Intergenic
1147248728 17:39139692-39139714 GGACCTGGGTGGGGGCACCCTGG - Exonic
1147918337 17:43901497-43901519 GTACCCTGATGGTGGCCTCTTGG - Intronic
1148711093 17:49681519-49681541 GGACCTGGAAGGGGACTCCTTGG + Intergenic
1148865249 17:50624926-50624948 GGCTCTGGAAGGTGGGCCCTAGG - Intronic
1152099893 17:78294828-78294850 AGCCCTGGCTGGTGACCCCTGGG + Intergenic
1152408439 17:80110343-80110365 GGCCCTGCCTGGAGGCCCCTGGG - Intergenic
1152637540 17:81436255-81436277 GGCCTTGGCTGGTGGCCCCTGGG - Intronic
1152755232 17:82084429-82084451 GGACCTGCCTGGGAGCCCCTCGG - Intronic
1154493888 18:14941747-14941769 AGACCTGGATCCTGGCCACTTGG - Intergenic
1157739940 18:50083447-50083469 TGAGATGGCTGGTGGCCCCTAGG - Intronic
1157876626 18:51279873-51279895 GGACTTTGCTGTTGGCCCCTGGG - Intergenic
1158370728 18:56800578-56800600 GGTCCTGGATCTTGGCCCCAAGG - Intronic
1161132509 19:2599463-2599485 GGACCTGGGAGGGGGGCCCTCGG + Intronic
1162774927 19:12973708-12973730 GGACCTGGATGATGTACTCTGGG + Exonic
1163731584 19:18952720-18952742 GGTCCTGGATGCTGGCCTCCGGG + Intergenic
1164916127 19:32053591-32053613 CAACCTGGATGTTGGCTCCTAGG - Intergenic
1165722281 19:38088079-38088101 GGACCACGATAGGGGCCCCTAGG - Intronic
1165781641 19:38438069-38438091 GGAGCAGGATGGTGGCCGCAAGG - Intronic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1166559144 19:43720223-43720245 AGACATGGATGGTGGGCCCAGGG + Intergenic
1167451603 19:49573447-49573469 GGCCCTGGTTGGTGGGGCCTGGG + Intronic
925902715 2:8519878-8519900 GGAACTGGAGGATGGACCCTGGG - Intergenic
926007603 2:9384721-9384743 GGTCCTGGAGGGTGGCACCCAGG - Intronic
926821472 2:16855445-16855467 GGCCCTGCATTGTGGCCCCCGGG - Intergenic
927520589 2:23695922-23695944 GGACATGGATGGGCGCCCTTGGG - Intronic
927717053 2:25359798-25359820 GGAGCTGAATGTGGGCCCCTGGG + Intergenic
927875653 2:26653632-26653654 TGTCCAGGATGGTGGCCCCCTGG - Intergenic
929587053 2:43123177-43123199 GGACCTGAATGGTGGGGCCAGGG - Intergenic
934976258 2:98804955-98804977 GGACCTGGTGGGTGCCCACTAGG + Intronic
937445586 2:121955301-121955323 GGGCTGGGCTGGTGGCCCCTTGG - Intergenic
942455935 2:176138479-176138501 GCACCTGGATAGTGGCTTCTAGG + Intergenic
947711024 2:232315946-232315968 GGGCTTGGAGGGTGGACCCTGGG - Intronic
947870800 2:233436852-233436874 GGACCTGGCAGGAGGCCACTGGG - Intronic
1170582728 20:17711256-17711278 GGCCCTGGAGGGGGGCCCCGGGG - Intronic
1172441330 20:34968657-34968679 TTATCTGGATGGTGACCCCTGGG + Intergenic
1173187944 20:40855629-40855651 GGACCTGGCTGGTGGAGTCTGGG - Intergenic
1173248439 20:41351969-41351991 GGCCCTTGATAGTGGACCCTTGG - Intronic
1176057008 20:63154380-63154402 GGCCCTGCACGGTGGTCCCTGGG - Intergenic
1176070730 20:63224939-63224961 GCGCCAGGATGCTGGCCCCTTGG + Intergenic
1176125717 20:63473587-63473609 GGGACTGGAGGGTGGCCCCAGGG + Intergenic
1176622523 21:9069397-9069419 GGAGGTGGATGGGGGCACCTGGG + Intergenic
1176655787 21:9588137-9588159 GGCACTGGATGGAGACCCCTGGG + Intergenic
1179185948 21:39085352-39085374 GGAGCTGTATTCTGGCCCCTGGG - Intergenic
1179618452 21:42596824-42596846 GCTCCTGGAGGGTGGCCCCTGGG - Intergenic
1179713848 21:43277733-43277755 TGGGCTGGATGGTGGCCCCTCGG - Intergenic
1180096385 21:45557166-45557188 GGAGCTGGAGGCTGGGCCCTGGG + Intergenic
1180160816 21:45997975-45997997 GGACCAGCAGGGTGGCCCCAGGG + Intronic
1180203963 21:46245443-46245465 TGACCTGCATGGTTGCCCCATGG + Intronic
1180561599 22:16619737-16619759 GGAACTAGATGGTGGTCTCTGGG + Intergenic
1180917696 22:19500218-19500240 TGTCCTGGTTGGTGGCCCTTTGG + Intronic
1181737294 22:24892088-24892110 AGACCTGGATGGAGGCTGCTGGG + Intronic
1183280468 22:36929459-36929481 TGACCTGGAGTGTGGCCCTTGGG + Exonic
1183692139 22:39396470-39396492 GGACCAGGATGGTGGCCATGAGG - Intergenic
1183788086 22:40043418-40043440 GCTCCTGGCTGGTGGCCACTGGG - Exonic
1183829757 22:40411530-40411552 GGACCTGGCTGATGGCCACCTGG - Exonic
1184797083 22:46738613-46738635 GGGCCTGGATGGGGGCGCCACGG + Intergenic
950147633 3:10663360-10663382 GTCCCTGGCTGGTGTCCCCTGGG - Intronic
954670978 3:52291238-52291260 GAGCCTGGATGGTGACTCCTGGG + Intronic
961426435 3:126851980-126852002 GGATCTGGAGGGAGGGCCCTTGG + Intronic
961509450 3:127392028-127392050 GCACCTGGATGGTTACCTCTAGG + Intergenic
965086414 3:164104807-164104829 GGAACTGCCTGGTGGCCACTGGG - Intergenic
967192104 3:186993227-186993249 GGCCCTGTTTGGTGGCCCTTGGG + Intronic
968453275 4:684927-684949 GGAGCTGGGAGGTGGCGCCTGGG - Intronic
969174313 4:5387074-5387096 AGAGCTGGGCGGTGGCCCCTGGG + Intronic
969307793 4:6335690-6335712 GGATCAGGATGGTGACACCTGGG - Intronic
972879927 4:43410449-43410471 TGGCCAGGATGGTGGCCCCACGG + Intergenic
979690504 4:123553930-123553952 GGAGCTGGAGGGGGGCCTCTGGG - Intergenic
984418131 4:179486700-179486722 GGAGCTGGCTGATTGCCCCTGGG + Intergenic
985581114 5:695627-695649 GGTCCTGGGTGGTGGCCGCATGG + Intergenic
985595738 5:786959-786981 GGTCCTGGGTGGTGGCCGCATGG + Intergenic
985617452 5:932230-932252 GGACCTGCAGTGTGGCCCCTGGG + Intergenic
985634255 5:1028217-1028239 GGACGTGGACGGTGGCCTCGGGG + Intronic
985695195 5:1336124-1336146 GCACATGGATGGTGGCCTCCAGG + Intronic
988856103 5:35229625-35229647 GGAGCTGGACGGAGGCACCTAGG - Intronic
990042439 5:51390154-51390176 GGACCTGGATGCTGCTCCCCCGG - Intronic
992220441 5:74566782-74566804 GCACCAGGACTGTGGCCCCTGGG + Intergenic
997303824 5:132824611-132824633 TTACCTGGCTGGGGGCCCCTGGG + Exonic
998893157 5:146768340-146768362 GGACTTGCATGGTGGCTCTTTGG - Intronic
999125389 5:149242347-149242369 GGAAAAAGATGGTGGCCCCTTGG + Intronic
999375142 5:151081237-151081259 GGCCCGGGACGGTGGCCCCAGGG - Intronic
999393898 5:151214336-151214358 GGCCCTGGAGTGGGGCCCCTTGG - Intronic
1006804871 6:36781626-36781648 GGACATGGATGGGGCTCCCTAGG - Intronic
1008129796 6:47707993-47708015 GAACCTTGATGGTGGTCACTTGG - Intronic
1022239286 7:28493614-28493636 GGAATTAGATGCTGGCCCCTGGG + Intronic
1024378974 7:48672473-48672495 AGCCTTGGATGGTGGCCCTTGGG + Intergenic
1024605262 7:51017818-51017840 GGAACTGGGAGGTGGGCCCTGGG + Intronic
1025252817 7:57363272-57363294 GGGCCTGGCTGGTGGCCTGTGGG + Intergenic
1025282476 7:57638324-57638346 GGCACTGGATGGAGACCCCTGGG + Intergenic
1025302246 7:57827083-57827105 GGCACTGGATGGAGACCCCTGGG - Intergenic
1030111422 7:106030202-106030224 GGTCCTGGAGGGTGGCACCAAGG + Intronic
1033645548 7:143300315-143300337 GCACCTGGGTGGTGGCTCCTGGG + Intronic
1034474712 7:151275720-151275742 GGACCAGGAGGGAGGCGCCTAGG - Intronic
1037624588 8:20595912-20595934 GGGCCAGGAGGGTGGCCTCTTGG + Intergenic
1038493779 8:27987785-27987807 GGACCTGGAGGATGGCACCTGGG - Intronic
1039896601 8:41720850-41720872 CGAACTGCATGGAGGCCCCTGGG - Intronic
1039931234 8:41991522-41991544 GGACCTGGATGGTGGTTTCATGG + Intronic
1041124521 8:54621648-54621670 GGATATGAATGGTGGCCCCCGGG + Intronic
1049412109 8:142478038-142478060 GGCCGTGGGTGGTGGCCCCCAGG + Intronic
1049426179 8:142538807-142538829 GACCCTGGATGGGGCCCCCTTGG + Intronic
1051236709 9:15007990-15008012 GGAGCTGGATGCTGTCCCTTAGG + Intergenic
1051710725 9:19927965-19927987 GCACCTGGCTGGGGGCCCCTGGG + Intergenic
1051995458 9:23210465-23210487 GGATCTGGATAGGGACCCCTGGG + Intergenic
1056195660 9:84225983-84226005 GGAACTGGATGATATCCCCTGGG + Intergenic
1056535569 9:87524542-87524564 GGACCTGGCTGGTGTCTCCTGGG - Intronic
1056545012 9:87606210-87606232 GTACCTGCAGGGTGGCGCCTGGG - Intronic
1060540848 9:124429145-124429167 GGAGTTGGCTGGTGGCCCTTGGG - Intergenic
1061908939 9:133712746-133712768 GGACATGGGTGGGGGACCCTGGG - Intronic
1062209633 9:135356673-135356695 GGACCTGGATGCTGGCAGGTGGG + Intergenic
1062476137 9:136728397-136728419 GGCCCTGGCTGCTGGCCCCGTGG - Intergenic
1062516709 9:136940569-136940591 GGCCCTGGACGGTGGCCCAGTGG - Exonic
1203633504 Un_KI270750v1:91598-91620 GGCACTGGATGGAGACCCCTGGG + Intergenic
1190323815 X:49194306-49194328 AGACCTTGGTGGTGCCCCCTCGG + Exonic
1190335313 X:49258364-49258386 GGCCCTGGAAGGTTCCCCCTGGG + Exonic
1190945476 X:55089217-55089239 GGAGCTGGATGACGGCCCCGAGG - Intronic
1191894428 X:65976742-65976764 TGACCTGGATGTTGACCCCCAGG + Intergenic
1195760524 X:108241036-108241058 GGATCTGGATGGTGGGTACTTGG + Intronic
1199731574 X:150638071-150638093 GGACCTGGGTGGTAGCCACGTGG + Intronic
1199771951 X:150980879-150980901 GAACCAGGGTGGTGGGCCCTTGG - Intronic