ID: 1135995288

View in Genome Browser
Species Human (GRCh38)
Location 16:27243486-27243508
Sequence GGGCAGGTTGATGTAGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135995288_1135995298 23 Left 1135995288 16:27243486-27243508 CCAAAATCTACATCAACCTGCCC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1135995298 16:27243532-27243554 AGCCAGACCTGCAGGAAGCCAGG 0: 1
1: 1
2: 3
3: 48
4: 349
1135995288_1135995296 15 Left 1135995288 16:27243486-27243508 CCAAAATCTACATCAACCTGCCC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1135995296 16:27243524-27243546 CACCTCTAAGCCAGACCTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135995288 Original CRISPR GGGCAGGTTGATGTAGATTT TGG (reversed) Intronic
901116481 1:6849302-6849324 AAGCAGTTGGATGTAGATTTGGG + Intronic
904346524 1:29875596-29875618 GGGCAGGTTGCTGCAGGTTGTGG - Intergenic
905598337 1:39228498-39228520 GGAAAGGTTGATGAAGATGTTGG + Intronic
906030391 1:42715638-42715660 GGGCACTTTGATTTTGATTTCGG + Intergenic
907538826 1:55193296-55193318 GGGCAGGTGGATACAGATTTTGG + Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
913247016 1:116879003-116879025 GGGGAGGTTGAAGCTGATTTGGG + Intergenic
914925473 1:151882646-151882668 GGGCATGTTGATGTATTTATGGG + Intronic
918190024 1:182164730-182164752 ACGCAGGTTTATGCAGATTTTGG + Intergenic
920552245 1:206872347-206872369 GGGCTGGTTGTTGCAGATTGTGG - Intergenic
921061847 1:211591915-211591937 GGGCAGGTAGATATGAATTTGGG - Intergenic
921569459 1:216761042-216761064 GGGGAGGTTGAGGTGGACTTTGG - Intronic
1066636086 10:37502503-37502525 TGGCAGGTACATGTAGATATAGG - Intergenic
1067289073 10:44928373-44928395 GGGCAGGTGGATGAAGAGGTGGG - Intronic
1067909049 10:50325758-50325780 GGGTAGGTAGATGTAGGTTCTGG - Intronic
1069065857 10:63941339-63941361 GGGCAGCTGGATGCAGATTGTGG + Intergenic
1071213681 10:83373877-83373899 GGGCAGGTTCCTGTAGATGTTGG - Intergenic
1073627135 10:105110884-105110906 GGGAAGGTTGGTGTTGATCTGGG - Intronic
1076341010 10:129744791-129744813 GGCCAGGTTGAAGTAGATGCCGG + Intronic
1083238350 11:61367033-61367055 GGGCAGGTGGATGTTGATACAGG + Intronic
1085053949 11:73393449-73393471 TAGCAGTTTGCTGTAGATTTGGG + Intronic
1085054142 11:73394346-73394368 AGGCTGGTTAATGTAGGTTTTGG - Intronic
1086326435 11:85706045-85706067 AGGCAGCATGATGTAGTTTTGGG + Intronic
1088234430 11:107707451-107707473 TGGCAGGTTGAATTAGAGTTTGG + Exonic
1093323516 12:17743617-17743639 AGGCACATTGATGTAGTTTTTGG + Intergenic
1096799187 12:54098205-54098227 GGGCAAGTTGAAGCAGAGTTAGG - Intergenic
1097123453 12:56753844-56753866 CAGCAGGTTGCTGTAGATTGTGG + Intronic
1099893657 12:88618863-88618885 GGGGCTGTTGATGCAGATTTGGG + Intergenic
1101405635 12:104426236-104426258 GCCCAGGTTGATGTGAATTTGGG - Intergenic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1107095828 13:36534044-36534066 GGGCAGGTTGCTGCAGATTGTGG + Intergenic
1107892596 13:44927346-44927368 GGGCAGGTTGCTGCAGGTTGCGG + Intergenic
1114201508 14:20525354-20525376 CTGCAGGTTGCTGCAGATTTCGG - Intergenic
1114489953 14:23094352-23094374 AGGCAGGTTGATATATATTGGGG - Intronic
1114563975 14:23614606-23614628 GGGCAGGGTGATGGGGATCTGGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1118472386 14:66086728-66086750 GGGAAGGCTGAAGAAGATTTAGG + Intergenic
1120902257 14:89585875-89585897 GGGCAGGATGAAGGAGATTAGGG + Intronic
1123786977 15:23684120-23684142 GGGCAGGTTTATTTTGATTCTGG + Intergenic
1124485740 15:30114202-30114224 GGGGAGGTTCCTGTAGATCTGGG + Intergenic
1124517835 15:30383066-30383088 GGGGAGGTTCCTGTAGATCTGGG - Intronic
1124540818 15:30583188-30583210 GGGGAGGTTCCTGTAGATCTGGG + Intergenic
1124547505 15:30644924-30644946 GGGGAGGTTCCTGTAGATCTGGG + Intronic
1124757838 15:32424392-32424414 GGGGAGGTTCCTGTAGATCTGGG - Intergenic
1126357730 15:47813748-47813770 GGGTCAGTTGATGTAGCTTTTGG + Intergenic
1127162373 15:56202901-56202923 TGGCAGTTTTATGTACATTTTGG - Intronic
1127428951 15:58883380-58883402 TGGCAAGTTGATATAGATATGGG - Intronic
1129281636 15:74489715-74489737 GGGGAGGTTGATGGAGAGATAGG + Intergenic
1130098276 15:80872191-80872213 GGGCCGGGTGAGATAGATTTTGG + Intronic
1135995288 16:27243486-27243508 GGGCAGGTTGATGTAGATTTTGG - Intronic
1136922316 16:34343538-34343560 GGGCTGGATGAGGTCGATTTGGG - Intergenic
1136982257 16:35068268-35068290 GGGCTGGATGAGGTCGATTTGGG + Intergenic
1137974546 16:53020274-53020296 GGACAAGTTGATGTTGCTTTGGG + Intergenic
1138023823 16:53506549-53506571 GGGCAATTTGCTGTTGATTTGGG + Intergenic
1142746250 17:1960163-1960185 GGGCGGGGTGATGTGAATTTGGG - Intronic
1143065932 17:4247292-4247314 GGGGCTGTTGCTGTAGATTTTGG - Intronic
1144224066 17:13127691-13127713 AGGCAGGTTGATGTAGGGTGTGG + Intergenic
1144411056 17:15002218-15002240 GGGCAGGTTGACGCAGGTATGGG - Intergenic
1144949310 17:18985461-18985483 GGGCAGGTTGGTGCAGAGCTGGG + Intronic
1145285642 17:21504140-21504162 GGGCTGGTTGCTGCAGATTATGG + Intergenic
1145391882 17:22461559-22461581 GGGCTGGTTGCTGCAGATTATGG - Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1151031163 17:70741848-70741870 TGGCATTTTGATGCAGATTTAGG - Intergenic
1151111369 17:71681969-71681991 GGGCATGTTGACTTAGATTTGGG - Intergenic
1151483855 17:74386505-74386527 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
1156041434 18:32827596-32827618 CGGAAGGTTGATCTAGGTTTAGG - Intergenic
1156310290 18:35916060-35916082 GGGAAGGCTGGTGTAGAGTTAGG - Intergenic
1157169508 18:45389524-45389546 AGGCTGGTTGAAGTTGATTTGGG - Intronic
1158272571 18:55732900-55732922 GAGCTGGTTGATGTTGATTGAGG + Intergenic
1158692766 18:59675965-59675987 GGGCGGGGGGATGTAGTTTTTGG - Intronic
1163840901 19:19609199-19609221 GGGTAGTTGGATGGAGATTTGGG - Intronic
1165875727 19:39005313-39005335 TGGCAGGTTGATGTCTTTTTTGG - Intronic
1168113174 19:54206482-54206504 GGGCAGGTGGAGGAAGATTCAGG - Intronic
925184241 2:1836285-1836307 GGGCAGGCTGATGGAGTATTGGG - Intronic
925184262 2:1836397-1836419 GGGCAGGTTGATGGAATCTTGGG - Intronic
926618453 2:15022975-15022997 GGGGAGGTTGATGTAGGTGAAGG - Intergenic
929791350 2:45025284-45025306 GGGCTGGATGAAGTAGATTCTGG + Intergenic
930663989 2:54083785-54083807 GGCCAGTTTTATGTAGAATTTGG - Intronic
932735478 2:74251391-74251413 ATTCAGGTTGATCTAGATTTAGG - Intronic
933255125 2:80072156-80072178 GGGCAGATGGAGCTAGATTTGGG - Intronic
933719752 2:85390395-85390417 GGGGTGGGTGATGGAGATTTTGG - Exonic
933787240 2:85853152-85853174 GGGCACGTTGATGTCAGTTTCGG - Intronic
934947868 2:98554894-98554916 GGGCAAGTAGATATGGATTTTGG + Intronic
935379935 2:102441243-102441265 GGCCTGCTTGATGAAGATTTAGG - Intronic
935444498 2:103141831-103141853 GGGCAGATTGCTGCAGATTATGG - Intergenic
935930424 2:108118115-108118137 GGGCAGGTTATTGTAGATAATGG + Intergenic
936398005 2:112143631-112143653 GAGCAGCATGATGTAGTTTTGGG - Intronic
936667365 2:114612099-114612121 GGAGACGTTGATGTAGAATTTGG - Intronic
938580277 2:132639402-132639424 GGGTATGTTGATGATGATTTAGG - Intronic
939223117 2:139328885-139328907 GGGAAGGTGGCTGTATATTTAGG - Intergenic
941329750 2:164165287-164165309 GGAGAGGTTTATGTACATTTGGG - Intergenic
942216421 2:173724312-173724334 GGCCAGGTAAATGTAAATTTTGG - Intergenic
944984738 2:205162755-205162777 GGACATTTTGATGTGGATTTAGG - Intronic
946037349 2:216754713-216754735 GGGCAGAGGGATGTAGGTTTAGG + Intergenic
946748339 2:222867606-222867628 GTGTGGGTTCATGTAGATTTAGG + Intronic
1169035415 20:2447151-2447173 GGGCAGGTTGATGCAAATTGAGG - Intergenic
1171797236 20:29576141-29576163 GGGCAAGTTGAAGCAGAGTTAGG + Intergenic
1171851017 20:30308020-30308042 GGGCAAGTTGAAGCAGAGTTAGG - Intergenic
1172570712 20:35968188-35968210 GGGCAGGTTAATGCAAATTAAGG + Intronic
1175310795 20:58010527-58010549 GGGCTGGTCGAAGTAGATCTGGG - Intergenic
1180907639 22:19426063-19426085 AGGCAGGTGACTGTAGATTTGGG - Intronic
1183512871 22:38246083-38246105 GCGCAGGTGCATGTAGATCTGGG + Exonic
1183884123 22:40863067-40863089 GGCCATGTTGATGGACATTTTGG + Intronic
951383455 3:22014543-22014565 GGGTAGGTGGATGTGGGTTTGGG - Intronic
952988114 3:38805706-38805728 GGGCAGGATCATGTAGAGTGAGG - Intergenic
953312993 3:41898183-41898205 GGGGAGGTTCCTGTAGATCTGGG - Intronic
954280156 3:49571479-49571501 GGGCAGCTTCAAGTAGCTTTGGG + Intronic
956999604 3:74870081-74870103 GGGCAGGTTTACTTAGAGTTGGG - Intergenic
958053889 3:88384802-88384824 GGGCAGATTGGTATATATTTGGG + Intergenic
959686631 3:109154347-109154369 GAGGAGGTGGATTTAGATTTAGG + Intergenic
960145098 3:114192373-114192395 GGGTAGCTTGCTGTAGATTGTGG + Intronic
960435935 3:117626615-117626637 GGGCAGTTTGATCTAGTATTAGG - Intergenic
965976482 3:174630008-174630030 GGGCAGGTTTATGTATATTATGG + Intronic
966507801 3:180726631-180726653 GTGCAGGTTGATTCAGGTTTTGG + Intronic
969969716 4:11033100-11033122 GGGTAGGTTGAAATAGATTTTGG + Intergenic
970147459 4:13051978-13052000 AAGCAGGTTGATGTAAAGTTTGG + Intergenic
970246795 4:14072482-14072504 GGGCTGGTTACTGTAGATATAGG - Intergenic
970246797 4:14072502-14072524 GGGCTGGTTACTGTAGATATGGG - Intergenic
970246804 4:14072535-14072557 GGGCTGGTTTCTGTAGATATGGG - Intergenic
970246810 4:14072568-14072590 GGGCTGGTTACTGTAGATATGGG - Intergenic
970246848 4:14072798-14072820 GGGCTGGTTACTGTAGATATGGG - Intergenic
970246855 4:14072831-14072853 GGGCTGGTTACTGTAGATATGGG - Intergenic
972274806 4:37546997-37547019 CGGCACTTTGATGTTGATTTTGG + Intronic
976775609 4:88702926-88702948 GGGCAGGTTGCTGCAGATTGTGG - Intronic
979263207 4:118671767-118671789 GGGCAGGTTCTTGTAGACTGCGG + Intergenic
981486719 4:145294665-145294687 GGCCAGGATGATGTAGGTGTAGG - Intergenic
981581410 4:146252040-146252062 GGGCAGGTAGATGGAGCCTTTGG + Intergenic
983811829 4:172072083-172072105 GGGCAGGTTGCTGCAGATTGTGG + Intronic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
986461358 5:7975744-7975766 GGGCTGGTTGATGCAGATCCTGG - Intergenic
989331236 5:40261378-40261400 GGGCAGATAAAAGTAGATTTTGG + Intergenic
992176981 5:74158771-74158793 GAGCAGGTAGATGTAGATTCTGG + Intergenic
992226520 5:74624305-74624327 GGGCTGGTTGCTGCAGATTGTGG + Intergenic
994158003 5:96524657-96524679 GGGCAGGGTGCTCTAGTTTTGGG - Intergenic
995007789 5:107221664-107221686 GGGCATGTAGGTGTAGACTTTGG - Intergenic
995622545 5:114042318-114042340 GGGCATTGTGATGTAGAATTAGG - Intergenic
998211493 5:140202431-140202453 TGGAAGGTTGATGTATGTTTTGG + Intronic
999531165 5:152464924-152464946 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1000276013 5:159735430-159735452 GGAGAGGCTGATCTAGATTTTGG + Intergenic
1001519813 5:172383271-172383293 GGGCAGATTAATGTGGAATTTGG - Intronic
1002269452 5:178060682-178060704 GGGCAGCATGAGGGAGATTTTGG - Intergenic
1003801209 6:9669412-9669434 AGGCATGTTGATGGAAATTTGGG - Intronic
1004174671 6:13329022-13329044 GGGCAGGTTGCTGCAGGTTGTGG + Intergenic
1008894784 6:56540512-56540534 GGGGAGAGTGATGTAGATTGTGG - Intronic
1013195680 6:107843585-107843607 AGGCAGGTTGATGAAGATGTGGG - Intergenic
1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG + Intergenic
1017499927 6:155014887-155014909 GGGCAGGCTCATGTTGAGTTTGG + Intronic
1017747681 6:157461426-157461448 GGGCAGATTGCTGTGGGTTTTGG + Intronic
1018929401 6:168230710-168230732 GGGCAGGCTGATGCAGGTGTGGG - Intergenic
1024461064 7:49659985-49660007 GTAGAGGTTGATGTAGATGTAGG - Intergenic
1026172432 7:67965786-67965808 GGGCAGTATGATGGAGTTTTTGG + Intergenic
1026320598 7:69264556-69264578 GGGCTGATATATGTAGATTTGGG - Intergenic
1030111692 7:106032214-106032236 GGGCAGGCTGGTGGAGATTGTGG + Intronic
1030136028 7:106249623-106249645 GGGCAGGTTAATAAACATTTTGG + Exonic
1031468573 7:122143697-122143719 GGGGCGGTGGATGGAGATTTCGG - Intronic
1031795584 7:126170269-126170291 GGGCTGGTTGCTGCAGATTGCGG + Intergenic
1038616596 8:29101438-29101460 GGGCTGCTTGACGTAGAATTGGG + Intronic
1039182102 8:34878420-34878442 GGGCTGGTTGTTGTAGGTATGGG - Intergenic
1039912309 8:41834973-41834995 GGGCAGGATGATGTCCATTCTGG - Intronic
1041872950 8:62655771-62655793 GGGGATGATGATGTATATTTTGG + Intronic
1043043262 8:75288883-75288905 GGGCTGGTTAATGTAGATAATGG - Intergenic
1044204558 8:89477462-89477484 GGGCAGATTGAGGTATATTTTGG + Intergenic
1047999046 8:130361837-130361859 GGGGAGGATGGTGTATATTTCGG - Intronic
1048213133 8:132473691-132473713 GGGCAAGTTGCTGTATCTTTGGG - Intronic
1048853372 8:138665208-138665230 GGGCAGGTCTGTGTAGATTTAGG - Intronic
1053486021 9:38456911-38456933 GGGCAGGTTGAGGATGACTTAGG + Intergenic
1055084526 9:72300428-72300450 AGGCAGTTTCATGTAGAATTTGG - Intergenic
1061752675 9:132791743-132791765 GGGCAGGTTGCTGCAGGTTGTGG - Intronic
1185883930 X:3764986-3765008 AGGCTGGTTGCTGTAGATCTTGG + Intergenic
1188341336 X:29006033-29006055 TGGAAGGTGGATGTAGATCTGGG - Intronic
1190230655 X:48579456-48579478 TGGCAGGTGGATGGAGACTTGGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1193678997 X:84494501-84494523 GTGCAGGTTGATGTAAAATCAGG - Intronic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196899430 X:120368385-120368407 GGGCAGGTTGATGTCCAGGTTGG - Intronic
1200781484 Y:7220301-7220323 AGGCTGGTTGCTGTAGATCTTGG - Intergenic