ID: 1135996849

View in Genome Browser
Species Human (GRCh38)
Location 16:27256702-27256724
Sequence GCACCATGTCCTGTCTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135996847_1135996849 -5 Left 1135996847 16:27256684-27256706 CCAGTTACTTAGAACTTAGCACC 0: 1
1: 0
2: 1
3: 11
4: 73
Right 1135996849 16:27256702-27256724 GCACCATGTCCTGTCTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 160
1135996846_1135996849 1 Left 1135996846 16:27256678-27256700 CCATCTCCAGTTACTTAGAACTT 0: 1
1: 0
2: 2
3: 32
4: 173
Right 1135996849 16:27256702-27256724 GCACCATGTCCTGTCTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 160
1135996845_1135996849 4 Left 1135996845 16:27256675-27256697 CCACCATCTCCAGTTACTTAGAA 0: 1
1: 0
2: 0
3: 31
4: 365
Right 1135996849 16:27256702-27256724 GCACCATGTCCTGTCTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 160
1135996844_1135996849 17 Left 1135996844 16:27256662-27256684 CCTACTGTTTCTTCCACCATCTC 0: 1
1: 0
2: 4
3: 44
4: 405
Right 1135996849 16:27256702-27256724 GCACCATGTCCTGTCTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135996849 Original CRISPR GCACCATGTCCTGTCTCCAA GGG Intronic