ID: 1135998183

View in Genome Browser
Species Human (GRCh38)
Location 16:27268957-27268979
Sequence ACTGAGGTGCAGGAGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 520}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135998183_1135998195 18 Left 1135998183 16:27268957-27268979 CCCTCCGCCTCCTGCACCTCAGT 0: 1
1: 0
2: 2
3: 48
4: 520
Right 1135998195 16:27268998-27269020 GGAAGAATTGGCGTGCAGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 110
1135998183_1135998196 19 Left 1135998183 16:27268957-27268979 CCCTCCGCCTCCTGCACCTCAGT 0: 1
1: 0
2: 2
3: 48
4: 520
Right 1135998196 16:27268999-27269021 GAAGAATTGGCGTGCAGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1135998183_1135998193 6 Left 1135998183 16:27268957-27268979 CCCTCCGCCTCCTGCACCTCAGT 0: 1
1: 0
2: 2
3: 48
4: 520
Right 1135998193 16:27268986-27269008 CCTGACCAAGGAGGAAGAATTGG 0: 1
1: 0
2: 3
3: 43
4: 321
1135998183_1135998189 -6 Left 1135998183 16:27268957-27268979 CCCTCCGCCTCCTGCACCTCAGT 0: 1
1: 0
2: 2
3: 48
4: 520
Right 1135998189 16:27268974-27268996 CTCAGTGACTTCCCTGACCAAGG 0: 1
1: 0
2: 1
3: 17
4: 201
1135998183_1135998190 -3 Left 1135998183 16:27268957-27268979 CCCTCCGCCTCCTGCACCTCAGT 0: 1
1: 0
2: 2
3: 48
4: 520
Right 1135998190 16:27268977-27268999 AGTGACTTCCCTGACCAAGGAGG 0: 1
1: 0
2: 2
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135998183 Original CRISPR ACTGAGGTGCAGGAGGCGGA GGG (reversed) Intronic
900753041 1:4411762-4411784 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
901089075 1:6629549-6629571 ACTGAGGGGCAGGAAGGGGTCGG - Intronic
901938492 1:12644446-12644468 AGTGAGGTGGAGGAGGCGGAGGG + Intergenic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
902699615 1:18162883-18162905 AGTGAGGTCCAGAAGGCAGAAGG + Intronic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903440901 1:23387228-23387250 CCGGAGGTGCAGGAGGCCGCAGG - Intronic
903706139 1:25287275-25287297 ACTGTGGGGCAGGAGGCTGAAGG - Intronic
903721099 1:25406099-25406121 ACTGTGGGGCAGGAGGCTGAAGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904417298 1:30371193-30371215 ACTGAGGCTCAGGAGACAGAGGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904430754 1:30462581-30462603 ACTGGGCTGCGGGAGGGGGAAGG + Intergenic
905051894 1:35058911-35058933 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
905906392 1:41621227-41621249 ACTGGGGGCCAGGAGGCTGAAGG - Intronic
906282813 1:44565805-44565827 ACTGGGTTGCAGGACGGGGATGG - Intronic
906689938 1:47785863-47785885 ACTGAGGCTCAGGAGGCGTGGGG - Intronic
906726406 1:48047676-48047698 ACTGAGATGGAGGAGGATGAGGG + Intergenic
906733165 1:48100604-48100626 ACTGAGGTTCCGGGGGTGGAAGG + Intergenic
907253088 1:53156262-53156284 ACCGAGGGGCACGAGGCAGAGGG - Intergenic
908137951 1:61152332-61152354 CCTGGGGTGCAGGAGGCCCAGGG - Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909875663 1:80799419-80799441 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
910852021 1:91657744-91657766 ACTTAGGGGCAGGATGAGGAAGG - Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
912326581 1:108769248-108769270 GCAGAGGTGGAGGAAGCGGAGGG + Intronic
912841603 1:113043993-113044015 GCTGAGGTGGAGTAGGGGGAGGG + Intergenic
913295979 1:117320908-117320930 ACTGAGGGGCAGGAGAAGGTTGG - Intergenic
913367066 1:118050379-118050401 ACTGAGGGGCATAAGGCAGAAGG - Intronic
914437066 1:147669933-147669955 GCCGAGCTGCAGGAGGCCGATGG - Exonic
916036333 1:160925879-160925901 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
917236819 1:172901585-172901607 ACTGATGTGCAGGTGGCACATGG + Intergenic
918048148 1:180953722-180953744 ACTGAGGTGCCTGAGGCAAAGGG - Intergenic
918096855 1:181343175-181343197 ACTGGGGTGGAGGAGGCTGGAGG + Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920649214 1:207824248-207824270 AGTGAGGTGCAGGAGGGGTGAGG - Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
922026025 1:221749780-221749802 ACTGAGTTTCAGGAGGATGAAGG + Intergenic
922101940 1:222484185-222484207 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922145617 1:222940785-222940807 ACTGAGGTACAGGTGGAGGTTGG + Intronic
922263020 1:223959307-223959329 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
922564598 1:226593486-226593508 ACAGAGGAGAAGGAGGCTGAGGG - Intronic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
922806311 1:228391723-228391745 ACTGGGGTGCAGGGGGCTCAAGG + Intergenic
922813907 1:228435565-228435587 ATTGAGGGGCAGGAGGGGGTCGG - Intergenic
923482401 1:234397364-234397386 GGTGAGGGGGAGGAGGCGGAGGG + Intronic
924344858 1:243064308-243064330 ACTGAACTCCAGGAGGAGGAGGG + Intergenic
924481160 1:244435577-244435599 ACAGAGGTGGAGGAGGATGAAGG - Intronic
1062992923 10:1836817-1836839 ACAGAGGTGCAGGTGGGAGAGGG - Intergenic
1063488200 10:6439522-6439544 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064321551 10:14310002-14310024 ACTGAGATGCACGAGGGCGAAGG - Intronic
1065640351 10:27776071-27776093 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1066129750 10:32381354-32381376 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067037451 10:42930892-42930914 ACAAAGGTGAAGGAGGCAGAGGG - Intergenic
1067084111 10:43229245-43229267 TGTGAGGTGCAGGCGGGGGAGGG - Intronic
1067179640 10:43974799-43974821 ACTGAGGTGCATGGGGCAGAGGG - Intergenic
1067512291 10:46906110-46906132 TCTGAGGTGCATAAGGCAGAAGG - Intergenic
1067649952 10:48145712-48145734 TCTGAGGTGCATGAGGCAGAAGG + Intergenic
1067954910 10:50780411-50780433 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1069174319 10:65271342-65271364 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1069786484 10:70991334-70991356 TCTGATCTCCAGGAGGCGGAGGG + Intergenic
1069982318 10:72260993-72261015 ACTGAGGAACGGGAGGGGGATGG - Intergenic
1070321946 10:75361003-75361025 ACTGTGGTGCAGGAGACAGCAGG + Intergenic
1070960711 10:80498345-80498367 ACTGAGGCCCAGGAGAGGGATGG + Intronic
1072252687 10:93593959-93593981 ATCGAGGTTCAGGAGGCGGCAGG + Exonic
1072722636 10:97790171-97790193 ACTGAGGTGCCAGAGGTTGAGGG - Intergenic
1073603518 10:104870501-104870523 GCTGAGGTGCAAGGGGTGGATGG - Intronic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1073956196 10:108874288-108874310 ATAGAGGTGCTGGAGGGGGAGGG - Intergenic
1074033575 10:109714377-109714399 ACTGAGGGGCATGAGACAGAAGG - Intergenic
1075618987 10:123911905-123911927 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1075824342 10:125341950-125341972 ACTGGGGTGCAGGGGACCGAGGG + Intergenic
1076719760 10:132387923-132387945 ACTGTGCTGCAGAAGGCAGATGG + Intergenic
1076725350 10:132410531-132410553 GCTGAGGTGCAGGACGGGCAAGG - Intronic
1076945553 10:133646813-133646835 ACTGAAGTCCAGGAGGCTGCGGG + Intergenic
1077246693 11:1542684-1542706 ACTGAGGTCCAGTAGAGGGAGGG + Intergenic
1078819316 11:14861685-14861707 ACTGAGGGGCATAAGGCAGAGGG + Intronic
1079114155 11:17630008-17630030 ACCGGGGTGCAGGTGGAGGATGG - Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1081104364 11:39046746-39046768 ACTGAGGTGTAGGAGACTCAAGG - Intergenic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083430244 11:62610690-62610712 ACTGAGATGGAGGAGGTCGAGGG + Intronic
1083804473 11:65065951-65065973 ACTGGGGTGTAGGCGGGGGAGGG - Intergenic
1084039414 11:66532681-66532703 AAGGGGGTGCAGGAGGCAGAGGG + Exonic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1087014860 11:93544731-93544753 ACTGAGGTGCAGAAAGCCCAAGG - Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088602867 11:111498239-111498261 GCTGAGGGGAAGGAGGCTGAGGG - Intronic
1089589827 11:119533187-119533209 CCTGAGCTGTAGGAAGCGGATGG - Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090158140 11:124463453-124463475 ACTGAGGTGTGGGAGGTGGTGGG - Intergenic
1090254434 11:125273396-125273418 ACCGAGGGGCAGGAGGAGGCGGG + Intronic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1091178402 11:133581552-133581574 ACAGAGGAGCAGGAGGCTGAGGG + Intergenic
1091587108 12:1822621-1822643 ACGGGGGTGCAGGAGGCTGGGGG + Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091770136 12:3146084-3146106 ACTGAGGTCCAGGAGGGGAGTGG - Intronic
1092170088 12:6369134-6369156 AGGGAGGGGCAGGAGGCAGAAGG - Intronic
1092356626 12:7800956-7800978 ACTGAGGAGGTTGAGGCGGAAGG - Intergenic
1092729073 12:11511339-11511361 TCTGAGGTCCAGGAGGCAGCTGG + Intergenic
1093112656 12:15170300-15170322 ACTCTGGCACAGGAGGCGGATGG + Intronic
1093860689 12:24162911-24162933 ACTGAAGTGAAGAAGGCTGAGGG - Intergenic
1096131000 12:49158920-49158942 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1096280464 12:50248473-50248495 ACTGTGGAGAAGGAGGAGGAGGG - Intronic
1096451357 12:51744686-51744708 ACTCAGGTGGTGGAGGCGGCAGG - Intronic
1096708878 12:53441144-53441166 AGGGAGGTGAAGGAGGCAGAGGG + Intergenic
1096817005 12:54208085-54208107 ACTTAGGTCCAGGAGGCGGCTGG - Intergenic
1097134149 12:56837348-56837370 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1097275150 12:57808071-57808093 CCTGAGGTGCCGGAGGGGAAAGG + Intronic
1097493772 12:60301870-60301892 ACTGAGAGGCATGAGGCAGAAGG - Intergenic
1097865872 12:64558861-64558883 AAGGAGGGGCAGGAGGCTGAGGG - Intergenic
1097891439 12:64781085-64781107 ACAGAGGAGGAGGAGGCGGCGGG + Intergenic
1097994817 12:65876923-65876945 AGTGAGGTGCTGGAGGAGGGTGG + Intronic
1101107689 12:101456178-101456200 ACTGAAGTGCAGTAGTGGGACGG + Intergenic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1103893081 12:124254417-124254439 ACTGAGGGGCTGGAGGCTAAAGG - Intronic
1104188477 12:126455206-126455228 ACTGACTTGCAGGAAGCTGAGGG + Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106220009 13:27738629-27738651 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107368339 13:39711589-39711611 ACTGATGAGAAGGAGGAGGAAGG - Intronic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108353074 13:49604950-49604972 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
1108781129 13:53835525-53835547 GCAGAGGTGGAGGAGGTGGAAGG - Intergenic
1109333848 13:60966966-60966988 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1110292346 13:73821710-73821732 AATGAGTTGTAGGATGCGGAGGG - Intronic
1111043144 13:82778170-82778192 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
1112463705 13:99624955-99624977 TCTGAGGTGAAGGTGGGGGAAGG - Intronic
1112578514 13:100658567-100658589 AGTGAGGTGAATGAGGGGGAAGG + Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114178639 14:20346146-20346168 AATGAGGTGTAGAAGGCTGATGG - Intronic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115807097 14:37063573-37063595 ACTGAGGTGCATGTTGTGGAGGG + Intronic
1116341259 14:43726157-43726179 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1116366888 14:44077716-44077738 GCTGTGGTCCAGGAGACGGAGGG - Intergenic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1117178364 14:53168355-53168377 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1117197249 14:53353029-53353051 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1118494194 14:66291896-66291918 ACTGAGGGGAGGGAGGTGGAAGG - Intergenic
1118532673 14:66724511-66724533 ACTGAGGGGCTGGAGTGGGAAGG + Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1119019302 14:71093720-71093742 TCAGAGGTGGAGGAGGTGGAAGG - Intronic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1120969999 14:90199269-90199291 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1121004279 14:90478459-90478481 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1121729584 14:96176949-96176971 ACAGAGGAGCAGGAGGAAGAGGG + Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122544202 14:102513258-102513280 ACTGTGCTGGAGCAGGCGGAGGG + Intergenic
1202919578 14_KI270723v1_random:18616-18638 ACTGAAGTCCAGGAGGCTGTGGG + Intergenic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124007454 15:25806158-25806180 AGAGAGGTGGAGGAGGTGGAAGG - Intronic
1124219347 15:27835754-27835776 ACTGAGGTGCTGGAGAATGAGGG - Intronic
1125041137 15:35188613-35188635 ACTGAGGGACAGAAGGCAGAAGG - Intergenic
1125503409 15:40253032-40253054 GCTCAGGTGCAAGAGGCGGCAGG - Intronic
1125595446 15:40882532-40882554 ACTGAGGTGCTGGATGCAGTGGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1129182356 15:73885285-73885307 ACTGAAGTGGAGAAGGGGGATGG + Intronic
1130932003 15:88436337-88436359 ACTGAATTGCAAGAGGGGGAGGG - Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132830777 16:1926994-1927016 ACAGAGGGCCAGGAGGCGGCTGG - Intergenic
1133298808 16:4769049-4769071 ACTGAGGTTCAGGGCGCGCAAGG - Intergenic
1133386971 16:5377533-5377555 ACGGAGGTGAGGGAGGAGGAGGG + Intergenic
1134851764 16:17484579-17484601 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135975473 16:27106462-27106484 ACAGAGATGCAAGAGGCGGGTGG - Intergenic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137469045 16:48738193-48738215 ACTGAGGTACAGCAGGGAGAAGG - Intergenic
1137674902 16:50299396-50299418 ACTGGGGAGCAGGAAGCAGATGG - Intronic
1138630372 16:58289500-58289522 ACTGAGGGGCAGGGGAGGGAAGG + Intronic
1138630808 16:58292987-58293009 AGAGAGCTGCAGGAGGCTGAGGG + Intronic
1138889539 16:61125926-61125948 ACTGTGGTGTAGGATGTGGATGG - Intergenic
1139010795 16:62631459-62631481 TGTGAGGTGGAGGAGGGGGAAGG - Intergenic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139748529 16:69094032-69094054 ACAGAGCTGCAGGAGGCTGAGGG + Intergenic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1140530695 16:75663345-75663367 ACTGAGGTGCAGGAGTGCTATGG + Intronic
1140541037 16:75756575-75756597 ACTGTGGTGCAGGAGGCCAGTGG + Intronic
1140754688 16:78056701-78056723 AATGAGCTGCAGGAGGTGGGAGG - Intronic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141440346 16:84025918-84025940 GCGGGGGTGCAGGAGGCAGAGGG - Intronic
1141556502 16:84839886-84839908 ACTGAGGTGGAGGTGGAGGTGGG + Intronic
1142126259 16:88412064-88412086 AGGGAGGTGCAGGGGGCGGGGGG + Intergenic
1142138480 16:88462142-88462164 ACGGAGGCACAGGAGGCTGAGGG - Intronic
1142237146 16:88927704-88927726 CCTGGGGAGGAGGAGGCGGAAGG - Intronic
1142243873 16:88959604-88959626 ACCCAGGTGCAGGAGAGGGAAGG + Intronic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142498551 17:319939-319961 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498562 17:319964-319986 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1142498573 17:319989-320011 ACTGAGGGGAGGGAGGGGGAGGG + Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143713758 17:8752903-8752925 ACTCAGGAGCCTGAGGCGGAAGG - Intergenic
1143968820 17:10777571-10777593 AGTGATGTGCAGGAGGCAGCTGG + Intergenic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1144971224 17:19111068-19111090 CCTGGAGCGCAGGAGGCGGAGGG + Intergenic
1144991526 17:19237231-19237253 CCTGGAGCGCAGGAGGCGGAGGG + Intronic
1145030703 17:19502739-19502761 ACTGTTGTGGAGGAGGCGGAAGG - Intronic
1145911834 17:28547606-28547628 ACTGAGCTGCGGGAGGGAGAGGG - Intronic
1147598647 17:41732793-41732815 ACAGTGCTGCAGGAGGCGGCAGG + Exonic
1147776808 17:42907642-42907664 ACTGGGGTGTAGGTGGTGGAGGG + Intronic
1148454086 17:47801597-47801619 ACTGAGGCTCAGGAGGTGAAAGG + Intergenic
1148699453 17:49578975-49578997 ACTGGGGGGCACGAGGCTGATGG - Exonic
1149760040 17:59220778-59220800 ACGGAGGTGGGGGAGGCTGAGGG + Intronic
1150827892 17:68492734-68492756 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1151821716 17:76500540-76500562 TCTGAGGAGCAGAAGGCGGTGGG - Intronic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152468714 17:80478912-80478934 ACTGTTGTGCAGGAGGCGCTGGG + Intergenic
1152615513 17:81336123-81336145 ACAGGGGTGGAGGAGGGGGAGGG - Intergenic
1152708084 17:81855742-81855764 ACTGGGGTTTAGGAGGCGGGCGG - Intronic
1152774407 17:82191532-82191554 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
1153514534 18:5891618-5891640 ACGGACGTGGAGGAGGAGGACGG + Exonic
1153711863 18:7808276-7808298 ACGGAGGTGGAGGTGGCTGAGGG + Intronic
1155027739 18:21957756-21957778 ACTGGGGGGCAGGAGGCGCTAGG - Intergenic
1156253875 18:35377093-35377115 ACTCAGGGGCAGGCAGCGGAGGG + Intronic
1157621007 18:49017499-49017521 ACTGAGGCCCAGGAGGGAGAGGG + Intergenic
1158381730 18:56938052-56938074 ACTGAGGGGGAGGAAGTGGAGGG + Intronic
1158412517 18:57220796-57220818 ACTGAGCTCCAGGAGGAGGGAGG - Intergenic
1158918173 18:62158275-62158297 CCTGTGGTGCAGGTGGCAGAGGG + Intronic
1159054630 18:63451598-63451620 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159539947 18:69761935-69761957 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1160406145 18:78647453-78647475 CCGCAGGAGCAGGAGGCGGAGGG + Intergenic
1160414857 18:78702007-78702029 AGTGAGATGCGGGAGGCAGAAGG - Intergenic
1160625531 18:80201783-80201805 GCTGGGGTGAAGGAGGCGGAGGG + Intronic
1160935724 19:1593607-1593629 ACTAAGGTGCAGGGGGTGGTCGG - Intergenic
1161021058 19:2011750-2011772 GCTGAGGAGCAGGAGCAGGAGGG - Intronic
1161310552 19:3591683-3591705 ACTGGGCTGCAGGATGGGGATGG - Exonic
1161390263 19:4016975-4016997 ACTGAAGTGCAGGAGGCAAGTGG + Intronic
1161442136 19:4298015-4298037 CCTGAGTTGGAGGAGGCTGAGGG - Exonic
1161727664 19:5939591-5939613 AAGGAGGTGCAGGCGGGGGAGGG + Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162495088 19:11019058-11019080 ACGGAGGTGCAGGCGGTGGTGGG + Intronic
1162825616 19:13249745-13249767 GCTGAGGTGGAGGGGGAGGATGG + Intronic
1162973410 19:14194807-14194829 ACTGAGGTGCAAGGTGGGGACGG - Intronic
1164180076 19:22810604-22810626 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1164624505 19:29717130-29717152 AATGAGGCCCAGGAGGCTGATGG - Intergenic
1164914288 19:32038029-32038051 ACTGAGGTTCAAGGGGCAGAGGG + Intergenic
1165328120 19:35125910-35125932 AGTGAGGTGCAGGCAGGGGAGGG - Intronic
1165348986 19:35266586-35266608 ACTGAGGGGCAGGGGCTGGAAGG + Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166683792 19:44782976-44782998 GCTGAGGTGCAGGGGTAGGACGG + Intronic
1166714061 19:44955399-44955421 GCGGCGGCGCAGGAGGCGGACGG + Exonic
1167050575 19:47075448-47075470 ACTGAAGAGGAGGAGGAGGAGGG - Intronic
1167222973 19:48215150-48215172 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1167643134 19:50692983-50693005 ACGGAGGTGCAGGAGGGTGTGGG - Intronic
1167716282 19:51144552-51144574 ACTGAGGAGCGGGTGGTGGAGGG - Exonic
1168218155 19:54941560-54941582 TCTGAGGTGGAAGAGGCTGATGG - Exonic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925239321 2:2309202-2309224 ACTGAAGTGCAGGTGGAGTATGG - Intronic
925751619 2:7094858-7094880 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
926439572 2:12874118-12874140 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
927551924 2:24008972-24008994 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
928854940 2:35791676-35791698 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
930591049 2:53326750-53326772 ACTGAGGGGCACAAGGCAGAAGG - Intergenic
931885031 2:66607900-66607922 AGTGAGGTGCATAAGGCAGAGGG - Intergenic
932823158 2:74918689-74918711 ACTGAGCTGAAGGAGCCAGATGG - Intergenic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
935422584 2:102885445-102885467 TCTGGGGAGCAGGAGGCTGAAGG - Intergenic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
936672728 2:114677113-114677135 ACTGGGCTGAAGGAGGCGGTAGG - Intronic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937714612 2:125017169-125017191 ACTGAGGGGCACCAGGCAGAAGG - Intergenic
938875945 2:135531604-135531626 ACTGAGGAGGAGGAGGCGGTTGG - Intronic
939858474 2:147389558-147389580 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
939969653 2:148644928-148644950 AAGGAGGTGGAGGAGGCGGCGGG + Intronic
942110014 2:172672988-172673010 ACTGAGGGGCATGAGGCAGAAGG + Intergenic
942681610 2:178482428-178482450 ACTGAGGAGGCGGAGGCGAAAGG + Intronic
943562154 2:189476917-189476939 GGTGAGGTGAAGGAGGCTGAGGG - Intergenic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
943903020 2:193465449-193465471 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
944333378 2:198499735-198499757 ACTGATGTTCAGGAGCAGGAAGG + Intronic
944586168 2:201175750-201175772 ACTGAGGGGCATAAGGCAGAAGG + Exonic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946053884 2:216884839-216884861 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
946201780 2:218074823-218074845 ACCCAGGTGCAGGAGGGAGAAGG + Intronic
947035625 2:225851127-225851149 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948900517 2:240954565-240954587 ACTGGGGTGCAGGAGGGTGCTGG - Intronic
1169205745 20:3739640-3739662 TCTGAGGTGCTGGAGGGGCAGGG - Intronic
1169410970 20:5370091-5370113 AATGAGGGGCAGGAGGCAGGAGG - Intergenic
1169884794 20:10387261-10387283 AGTGAGGAGCAGGATGCTGATGG + Intergenic
1171010006 20:21504423-21504445 ACTGAGGGGGAGTAGGCTGAGGG - Intergenic
1171783540 20:29442907-29442929 ACTGAAGTCCAGGAGGCTGTGGG + Intergenic
1172949824 20:38715779-38715801 GGTGAGATGCAGGAGGGGGAGGG - Intergenic
1173538996 20:43837659-43837681 AAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1173924974 20:46773963-46773985 ACCGAGGCGCAGAAGGCAGAAGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175948784 20:62571567-62571589 CCTGAGGTGGGGGAGGGGGATGG + Intergenic
1176041517 20:63068430-63068452 ACTGGGGTGCAGGGAGGGGACGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178842120 21:36146219-36146241 AATGAGGTGCATGAGAGGGAAGG + Exonic
1179007608 21:37529175-37529197 GCTGGAGTGCAGGAGGCTGAGGG - Intergenic
1179254821 21:39706504-39706526 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180059076 21:45375464-45375486 ACAGAGGTGGGGGAGGAGGAGGG + Intergenic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1181099306 22:20528690-20528712 ACTGCGATGGAGGAGGCTGATGG + Intronic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1182495702 22:30705833-30705855 ACTGGAGTGGAGGAGGGGGAGGG + Intronic
1183256718 22:36767125-36767147 ACTGAGGAGGTGGAGGAGGAAGG - Intronic
1183688319 22:39374655-39374677 AATGAGGTGCAGGCGGGTGAAGG + Intronic
1183947063 22:41332496-41332518 AATGTGGGGCAGGAGGCAGAAGG - Intronic
1184116627 22:42426321-42426343 GCTGAGGTGGAGGAGGGGCAGGG - Intronic
1184230831 22:43157463-43157485 ACTGAGGTCCAGGGAGGGGAGGG + Intronic
1184241711 22:43214456-43214478 TCTGAGGTGCAGCAGCCAGAGGG - Intronic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1185210691 22:49569056-49569078 GCTGAGGTGCAGGAGGAGCCGGG - Intronic
949544958 3:5064849-5064871 GCTTAGGCCCAGGAGGCGGAGGG + Intergenic
949676454 3:6459844-6459866 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
950267403 3:11584831-11584853 TCTGGGCTTCAGGAGGCGGAAGG + Intronic
950765179 3:15268117-15268139 ACTAGGGGGCAGGAGGCGCAAGG + Intronic
951080626 3:18445870-18445892 AGTGAGGAGCACGTGGCGGAAGG + Intergenic
951847229 3:27097556-27097578 ACTGAGGTGATGGAAGAGGAAGG + Intergenic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
952332154 3:32374011-32374033 ACTGTGGTGGAGGAGGAGGGTGG - Intergenic
952387247 3:32850924-32850946 CCTGAGGTGCAGGTTGGGGAGGG + Intronic
953798938 3:46006627-46006649 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954653364 3:52178692-52178714 CCTGAGGAGCAGCAGGCAGAAGG + Intergenic
955403996 3:58613807-58613829 ACTGATGGGCAGGAGGCAGAAGG + Intronic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
957222598 3:77402951-77402973 ACTGAGGGGCATAAGGCAGAAGG - Intronic
958566282 3:95815542-95815564 ACTGAGAGGCAGGAGAGGGAGGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
960044872 3:113186899-113186921 ATGGAGGAGCAGGAGGCTGAGGG + Intergenic
960709411 3:120512270-120512292 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
961320303 3:126068383-126068405 ATTGGGGTGCAGGAGGCTGGTGG - Intronic
961394762 3:126578983-126579005 ACTGAGGGTCAGGAGGTGAAGGG - Intronic
961496912 3:127299958-127299980 CCTGAGGTGCAGAAGGCTGTTGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961966854 3:130914054-130914076 ACTAAGGAGGAGGAGGAGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
964249792 3:154699735-154699757 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
965619571 3:170629412-170629434 ACTGTGGTGCAGGGGGCAGCAGG + Intronic
965760227 3:172068001-172068023 ACTGAGGTGGAGGAGTGGGGAGG - Intronic
967293274 3:187942566-187942588 ACTGTGGTGGAGGAGAGGGATGG - Intergenic
967462027 3:189758660-189758682 ACTGAGGGGCATAAGGCAGAGGG - Intronic
967999189 3:195191239-195191261 GCAGAGGTGGAGGAGGTGGAAGG - Intronic
968929052 4:3566505-3566527 ACTGCGGTGGAGGAGGCCGTGGG + Intergenic
970471104 4:16380055-16380077 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
972241874 4:37202229-37202251 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
974092902 4:57330799-57330821 ACTGACGTTGAGGAGGCAGAAGG + Intergenic
974875827 4:67701303-67701325 GCTGTGGTGCAGGTGGCCGAAGG + Intergenic
975038343 4:69712149-69712171 ACTGAGGTCTAGGAGAAGGAAGG + Intergenic
976008547 4:80459558-80459580 ACTGAGGGGCATAAGGCAGAAGG - Intronic
977233293 4:94477765-94477787 AAAGAGGTGGAGGAGGTGGAAGG - Intronic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978668918 4:111222617-111222639 ACTGAGGTGCATAAGGCAGAAGG + Intergenic
978803362 4:112775826-112775848 ACTGACGTCTTGGAGGCGGATGG + Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
981048909 4:140292045-140292067 ACAGAGGAGCAGGAGGCAGAGGG - Intronic
981049668 4:140297766-140297788 ACAGAGGTGCAGGAGACAGTGGG + Intronic
982117750 4:152112260-152112282 AATGGGGTGGAGGAGGAGGAGGG - Intergenic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
983168769 4:164512206-164512228 AAAGAGGTGCAAGAGGAGGAAGG - Intergenic
983406310 4:167335475-167335497 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
984084480 4:175291993-175292015 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
984853878 4:184176559-184176581 ACTGAACTGCAGGAGGGAGAAGG + Intronic
984999206 4:185468300-185468322 ACTGAGGTGTACGAGGTGTACGG + Intronic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985448940 4:190047325-190047347 ACTGAAGTCCAGGAGGCTGTGGG + Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985823675 5:2178025-2178047 ACGGAGGTGAAGGAGGAGCAGGG + Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
986763167 5:10898385-10898407 GCAGAGGTGGAGGAGGTGGAAGG + Intergenic
986977804 5:13412573-13412595 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
987244464 5:16034571-16034593 AGTGAGGTCCAGGAGGCTAAAGG + Intergenic
989743437 5:44799047-44799069 ACTGAGGTGGGGGTTGCGGATGG - Intergenic
990018583 5:51097970-51097992 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990114281 5:52369291-52369313 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990311488 5:54543229-54543251 ATGGAGGTGCAGAAGGCTGACGG + Intronic
990318055 5:54602571-54602593 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
992125152 5:73632201-73632223 ACTGGGGTACAGGGGGAGGAGGG + Intronic
992399121 5:76395538-76395560 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
994024279 5:95063703-95063725 ACTGAGGTGGCTGAGGCAGAAGG - Intronic
994754016 5:103772825-103772847 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995482897 5:112610398-112610420 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
996344885 5:122477515-122477537 ACTGCTGGGCAGGAGGGGGAGGG + Intergenic
996710886 5:126542554-126542576 ACTGGGGAGCATGAGGTGGAAGG + Exonic
998401235 5:141850128-141850150 ACTCAGGTGCAGGATGGGGTGGG - Intergenic
998796095 5:145820710-145820732 ACTGAGGGGCATAAGGCAGAAGG + Intronic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
999030805 5:148288869-148288891 ACTGAGGTGCAGTGAGCTGAGGG + Intergenic
1000838673 5:166188486-166188508 ACTGAGGGGCAGCAGGAGGGAGG + Intergenic
1000867507 5:166533314-166533336 AGTGAGGTGCAGGGGTAGGAGGG - Intergenic
1000994997 5:167949835-167949857 AACGAGGTGCAGGAGACAGAAGG - Intronic
1001589681 5:172856831-172856853 ACTGAGGTGCAAGGGTAGGAGGG - Intronic
1001663542 5:173413989-173414011 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1002301380 5:178259250-178259272 AATGAGGTGAAGGAGGAGGCTGG + Intronic
1002978740 6:2112851-2112873 ACTGAAGTGGAGGAGGCAGAGGG - Intronic
1003048285 6:2756213-2756235 AGTGAGGTTCAGGATGGGGATGG - Intergenic
1005255379 6:23997270-23997292 GCAGAGGTGGAGGAGGGGGAAGG - Intergenic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005844906 6:29769635-29769657 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005859902 6:29892300-29892322 ATTGAGGAGCAGGAGACTGAGGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1006056307 6:31387071-31387093 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006066659 6:31467103-31467125 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006295373 6:33167743-33167765 TCTGAGGGGTGGGAGGCGGAGGG + Intronic
1006620240 6:35358896-35358918 ACTGAGGTGGGGGAAGTGGAGGG + Intronic
1007675528 6:43590838-43590860 ACTTGAGTCCAGGAGGCGGAGGG + Intronic
1008004114 6:46391834-46391856 ACTGAGGTGGAGGAGAGGAAAGG + Intronic
1008363050 6:50644171-50644193 ACTGTGGTGCAGTCGGGGGAGGG - Intergenic
1009401552 6:63262302-63262324 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1010632356 6:78213191-78213213 AATTAGGTGGAGGAGGAGGAAGG - Intergenic
1010977293 6:82330040-82330062 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1012969056 6:105707042-105707064 AAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1013236950 6:108205532-108205554 AGAGAGGTGGAGGAGGTGGAAGG - Intergenic
1015493632 6:133856259-133856281 ACCAAGGTGGAGGAGGGGGAGGG - Intergenic
1015706568 6:136094340-136094362 AGTGAGGTGCAGGAGTGTGAGGG - Intronic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017789213 6:157781270-157781292 ACGGAGGTGAAGGAGCCAGACGG - Intronic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1018134900 6:160769609-160769631 ACTGAGGGGCATGAGGCAGAAGG - Intergenic
1018376683 6:163219627-163219649 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018376691 6:163219662-163219684 GCTGAGCTGCAGGAGGAGGCAGG - Intronic
1018619475 6:165715991-165716013 ACTTTAGTGCAGGAGCCGGAGGG - Intronic
1018821142 6:167375184-167375206 TCTGGGGTGCAGGAGGCCCAGGG + Intronic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019316085 7:387577-387599 ACTGAGGCGCAGGAAGGGCACGG + Intergenic
1019513359 7:1429321-1429343 CCTGAGACGCAGGAGGCTGACGG - Intronic
1019539712 7:1546170-1546192 CCTGAGGAGCAGGACGCGGTGGG - Exonic
1020179205 7:5908219-5908241 ACTGGGGAGGAGGAGGCAGAAGG + Intronic
1020303728 7:6816637-6816659 ACTGGGGAGGAGGAGGCAGAAGG - Intronic
1022216700 7:28270093-28270115 ACTGAGATGAAGGAGGCTTATGG + Intergenic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1023642803 7:42277596-42277618 ACTGAGGTTCAGGTGCCTGAGGG - Intergenic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1024674839 7:51629042-51629064 TCAGAGGTGCTGGAGGCTGATGG + Intergenic
1024737931 7:52325134-52325156 ACTGAGGCACAGGAGGCAGGTGG + Intergenic
1025709406 7:63893062-63893084 ACTGAGGTCCTGGAGGCTGGAGG + Intergenic
1026928763 7:74211177-74211199 GCTGAGGTGGAGGGAGCGGAGGG - Intronic
1028581187 7:92411174-92411196 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1028895730 7:96039715-96039737 ACTGAGGTGCAGGCAGTGAAGGG - Intronic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1030005267 7:105112391-105112413 AAGGAGGTGGAGGAGGTGGAGGG - Exonic
1031889648 7:127279179-127279201 ACTGAGGAGGAGGAGGAAGACGG - Intergenic
1032139851 7:129318336-129318358 ACTCAAGAGCATGAGGCGGAAGG - Intronic
1034927135 7:155131384-155131406 TCTGGGGTGCTGGAGACGGAAGG - Intergenic
1035680426 8:1483614-1483636 ACTGCTGTGCAGGAGGCTCAGGG + Intergenic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036195315 8:6708608-6708630 ACTGAGGCCCGGGAGGCGGGCGG + Exonic
1036512937 8:9417433-9417455 ACTGAGCTGCAGAAGGCCTAGGG - Intergenic
1036655909 8:10677168-10677190 AATGAAGTGCAGGAGGAGGAGGG - Intronic
1036811476 8:11869800-11869822 ACTGAGGACCAGGAGGCTGGAGG + Intergenic
1036816270 8:11905231-11905253 ACTGAGGTGCAGGATGAAAATGG + Intergenic
1037664358 8:20955383-20955405 ACTGCAGGGCAGGAGGCGAATGG + Intergenic
1037841638 8:22249253-22249275 ACAGAGGTGCAGGGCGAGGACGG + Exonic
1037968975 8:23158215-23158237 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1038874601 8:31534428-31534450 ACTGAGGGGCATTAGGCAGAGGG + Intergenic
1039414352 8:37380590-37380612 CCTGAGCTGCAGGAGGCCCATGG - Intergenic
1039586772 8:38713572-38713594 ACTGTTGTCCAGGAGGCGGCTGG - Intergenic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1040522962 8:48193532-48193554 ACTGAGTTACAGGAGGCAGAAGG + Intergenic
1041375103 8:57204606-57204628 ACTGAGGGGCACAAGGCAGAGGG + Intergenic
1041377279 8:57217061-57217083 ACTGAGGGGCATGAGGCGGAGGG + Intergenic
1042078587 8:65023995-65024017 ACTGTGATGCTGGGGGCGGAGGG - Intergenic
1042381498 8:68119625-68119647 ATTGAGGTAAAGGAGGTGGAAGG - Intronic
1043599581 8:81920666-81920688 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1044003684 8:86916181-86916203 ACTAAGGGGCATGAGGCAGAAGG + Intronic
1044085511 8:87937765-87937787 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1044106101 8:88209204-88209226 GAAGAGGTGCAGGAGGTGGAAGG - Intronic
1044362904 8:91309617-91309639 ACTAAGGTGCATAAGGCAGAAGG + Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045222503 8:100212995-100213017 GCGGGGGTGCAGGACGCGGAGGG - Intronic
1047308087 8:123669357-123669379 TCTGAGGTGCAGGTGCCAGATGG - Intergenic
1049188557 8:141272686-141272708 ACTGAGGGGCAGCGGGCAGAGGG - Intronic
1050847417 9:10239820-10239842 ACTGAGGGGCAAGAGGCAGGAGG - Intronic
1053472352 9:38355902-38355924 CCTGAGGTCCAGGAGAGGGATGG - Intergenic
1053577054 9:39363972-39363994 ACTGGGGTGCAGGGGGCAGTGGG + Intergenic
1053803760 9:41780083-41780105 ACTGCGGTGGAGGAGGCCGTGGG + Intergenic
1054098624 9:60922662-60922684 ACTGGGGTGCAGGGGGCAGTGGG + Intergenic
1054192059 9:61991475-61991497 ACTGCGGTGGAGGAGGCCGTGGG + Intergenic
1054646320 9:67596315-67596337 ACTGCGGTGGAGGAGGCCGTGGG - Intergenic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055107035 9:72523680-72523702 GTAGAGGTGCAGGAGGTGGAAGG + Intronic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057336690 9:94161181-94161203 ACTTGGGCGCAGGAGGCAGAGGG - Intergenic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1057906730 9:98989193-98989215 AGTGGGCTGCAGGAGGCAGACGG + Exonic
1058145882 9:101410889-101410911 ACTGAGGTACAGGAGAAGGAGGG - Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058910073 9:109512896-109512918 ACTTAGGGGCAGGAGGAGGGAGG - Intergenic
1059438838 9:114291394-114291416 TCTGAGACACAGGAGGCGGAGGG + Intronic
1059835514 9:118147799-118147821 ATTGAGGTGGAGGTGGGGGAGGG - Intergenic
1059964674 9:119601967-119601989 ACTGAGGCCCAGGAAGGGGAAGG - Intergenic
1060077379 9:120604541-120604563 ATTGGGGAGCAGGAGGCTGATGG - Exonic
1060452395 9:123755493-123755515 GCTGAGGTGGAAGAGGAGGAAGG - Intronic
1060826120 9:126689044-126689066 ACTGAGGTGGGGGACGCTGAGGG + Intronic
1061001121 9:127903638-127903660 TCTGAGGCTCAGGAAGCGGATGG - Intronic
1061002829 9:127912108-127912130 AATGGGGGGCAGGAGGCAGAGGG - Intronic
1061680021 9:132238353-132238375 GGTGGGGTGCAGGAGGCGGCAGG + Intronic
1061865684 9:133490830-133490852 AAGGAGGTGCTGGAGGAGGAGGG + Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1185877705 X:3713589-3713611 ACCGAGCTGGAGGAGGCGGCGGG - Exonic
1185894267 X:3843873-3843895 ACCGAGCTGCAGGAGGCCGCGGG - Intergenic
1185899386 X:3882297-3882319 ACCGAGCTGCAGGAGGCCGCGGG - Intergenic
1185904503 X:3920726-3920748 ACCGAGCTGCAGGAGGCCGCGGG - Intergenic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1187414999 X:19085899-19085921 ACTGAGGTAGAGCAGGCGAAGGG - Intronic
1188284490 X:28311498-28311520 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1188883345 X:35518061-35518083 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1190497895 X:51044265-51044287 TCTTAGGTGCAGGAGTGGGAGGG + Intergenic
1192459571 X:71305279-71305301 ATTGAGCAGCAGGAGGCTGAAGG + Exonic
1193746434 X:85288228-85288250 ACTGAGGGGCAGGAGGTAGTTGG - Intronic
1194215237 X:91123336-91123358 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1194627595 X:96243664-96243686 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1194810609 X:98382945-98382967 ACTGAGGGGCATAAGGCTGAAGG - Intergenic
1195039502 X:101001342-101001364 ACTGAGGAGGATGAGGCGGGAGG - Intergenic
1195431238 X:104791770-104791792 ACTGAGGTTCAGTAAGAGGAAGG - Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196086171 X:111684428-111684450 ACTGGGGAGCCTGAGGCGGAAGG - Intronic
1197207205 X:123800549-123800571 ACTCAGGTGGCTGAGGCGGAAGG - Intergenic
1198455990 X:136818303-136818325 GCTGAGGTGGAAGAGGTGGAAGG + Intergenic
1198764013 X:140062695-140062717 CCTGAGGTGCTTGAGGGGGAGGG + Intergenic
1198957790 X:142150665-142150687 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1200267943 X:154655890-154655912 ACAGAGGCGCAGGAGGAGGCCGG - Intergenic
1200464184 Y:3494605-3494627 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1200787626 Y:7273982-7274004 ACCGAGCTGGAGGAGGCGGCGGG + Intergenic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic