ID: 1136014141

View in Genome Browser
Species Human (GRCh38)
Location 16:27384048-27384070
Sequence GTGTGGGTGGGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136014141_1136014157 8 Left 1136014141 16:27384048-27384070 CCCTCTGCCCTCCCCACCCACAC No data
Right 1136014157 16:27384079-27384101 TCATCATTCCCCGAACAGGCGGG No data
1136014141_1136014156 7 Left 1136014141 16:27384048-27384070 CCCTCTGCCCTCCCCACCCACAC No data
Right 1136014156 16:27384078-27384100 CTCATCATTCCCCGAACAGGCGG No data
1136014141_1136014153 4 Left 1136014141 16:27384048-27384070 CCCTCTGCCCTCCCCACCCACAC No data
Right 1136014153 16:27384075-27384097 GCCCTCATCATTCCCCGAACAGG No data
1136014141_1136014158 9 Left 1136014141 16:27384048-27384070 CCCTCTGCCCTCCCCACCCACAC No data
Right 1136014158 16:27384080-27384102 CATCATTCCCCGAACAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136014141 Original CRISPR GTGTGGGTGGGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr