ID: 1136015199

View in Genome Browser
Species Human (GRCh38)
Location 16:27393965-27393987
Sequence GACAGGCATGAGCCACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136015199_1136015203 -4 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015203 16:27393984-27394006 TGTCATCCCAGCACTTTGGGAGG 0: 3057
1: 295903
2: 265941
3: 152999
4: 135364
1136015199_1136015200 -8 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015200 16:27393980-27394002 TGCCTGTCATCCCAGCACTTTGG 0: 886
1: 93687
2: 232210
3: 241197
4: 215007
1136015199_1136015201 -7 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015201 16:27393981-27394003 GCCTGTCATCCCAGCACTTTGGG 0: 2336
1: 222058
2: 272284
3: 184421
4: 142266
1136015199_1136015209 25 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015209 16:27394013-27394035 TGAGTGGATCACCTGAGGTCAGG 0: 735
1: 17534
2: 46652
3: 81987
4: 100264
1136015199_1136015206 9 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015206 16:27393997-27394019 CTTTGGGAGGCCAAGATGAGTGG 0: 129
1: 3156
2: 31167
3: 87317
4: 162304
1136015199_1136015208 20 Left 1136015199 16:27393965-27393987 CCAGGTGGTGGCTCATGCCTGTC No data
Right 1136015208 16:27394008-27394030 CAAGATGAGTGGATCACCTGAGG 0: 20
1: 587
2: 7261
3: 25333
4: 54831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136015199 Original CRISPR GACAGGCATGAGCCACCACC TGG (reversed) Intergenic
No off target data available for this crispr