ID: 1136016864

View in Genome Browser
Species Human (GRCh38)
Location 16:27406046-27406068
Sequence TGGGGAAAGGAGGCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1667
Summary {0: 1, 1: 2, 2: 26, 3: 223, 4: 1415}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136016864_1136016874 6 Left 1136016864 16:27406046-27406068 CCTCTCTGGGCCTCCTTTCCCCA 0: 1
1: 2
2: 26
3: 223
4: 1415
Right 1136016874 16:27406075-27406097 AAGCGGGCTTGACTAGGACGAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1136016864_1136016872 0 Left 1136016864 16:27406046-27406068 CCTCTCTGGGCCTCCTTTCCCCA 0: 1
1: 2
2: 26
3: 223
4: 1415
Right 1136016872 16:27406069-27406091 TCTGCCAAGCGGGCTTGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 67
1136016864_1136016875 7 Left 1136016864 16:27406046-27406068 CCTCTCTGGGCCTCCTTTCCCCA 0: 1
1: 2
2: 26
3: 223
4: 1415
Right 1136016875 16:27406076-27406098 AGCGGGCTTGACTAGGACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 31
1136016864_1136016868 -10 Left 1136016864 16:27406046-27406068 CCTCTCTGGGCCTCCTTTCCCCA 0: 1
1: 2
2: 26
3: 223
4: 1415
Right 1136016868 16:27406059-27406081 CCTTTCCCCATCTGCCAAGCGGG 0: 1
1: 0
2: 0
3: 44
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136016864 Original CRISPR TGGGGAAAGGAGGCCCAGAG AGG (reversed) Intronic
900295521 1:1947201-1947223 TGGGGCACCCAGGCCCAGAGAGG + Intronic
900420988 1:2555873-2555895 TGGGGCAGGGAAGCCCAGTGGGG + Intronic
900613812 1:3555400-3555422 TGGGTGGTGGAGGCCCAGAGCGG - Intronic
900927896 1:5717582-5717604 TAGGGAAAGAAGGCTCAAAGCGG - Intergenic
901056148 1:6449374-6449396 TGGTGGGAGGAGGCCCAGAGAGG - Intronic
901065755 1:6493501-6493523 AAGGAAACGGAGGCCCAGAGAGG - Intronic
901163520 1:7198558-7198580 TCTGGAAATGAGACCCAGAGAGG - Intronic
901207450 1:7505197-7505219 GCAGGAAAGGAGGCCCTGAGTGG + Intronic
901466633 1:9425907-9425929 TGAGGACACCAGGCCCAGAGAGG + Intergenic
901642157 1:10698081-10698103 GGGAGAAAGGAGCCACAGAGTGG + Intronic
901671997 1:10861571-10861593 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
901700960 1:11044622-11044644 TGGGGCACTGAGGCCCGGAGAGG - Intronic
901850395 1:12011331-12011353 GGGGAAAAGGAGGCCCAGAGGGG - Intronic
901871359 1:12140848-12140870 AGGGGAGAGAAGGCCCAGAGGGG - Intronic
901935740 1:12625476-12625498 TAGGAAACTGAGGCCCAGAGAGG + Intergenic
901988083 1:13091791-13091813 TGGGGCAAGAAGGCCCAGAAAGG - Intergenic
901993729 1:13134976-13134998 TGGGGCAAGAAGGCCCAGAAAGG + Intergenic
902281303 1:15376612-15376634 TGGGAAATGGAGTCCCAGAAAGG - Intronic
902295183 1:15462368-15462390 GGGGAAACTGAGGCCCAGAGAGG - Intronic
902298042 1:15481904-15481926 GGGGAAACTGAGGCCCAGAGAGG - Intronic
902384581 1:16069072-16069094 AGGGAAACGGAGGCTCAGAGAGG + Intronic
902388453 1:16089088-16089110 AGGGGAACTGAGGCCCCGAGAGG - Intergenic
902397614 1:16141021-16141043 GTGGGAAAGGAGGCCCGGTGAGG - Intronic
902431617 1:16367563-16367585 TCAGGAAAGGAGGCCCCGGGTGG - Intronic
902466594 1:16622267-16622289 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
902508064 1:16950782-16950804 AGGGAAACTGAGGCCCAGAGAGG + Intronic
902519543 1:17008404-17008426 TGAGAAATGGAAGCCCAGAGAGG - Intronic
902520371 1:17012175-17012197 TTGGGAAAAGAGGGCCAGAGAGG - Intergenic
902527663 1:17069919-17069941 GAGGAAATGGAGGCCCAGAGAGG + Intronic
902541635 1:17159684-17159706 TGAGGAACTGAGGCCTAGAGAGG - Intergenic
902548804 1:17207249-17207271 TGAGGAAATGAAACCCAGAGAGG - Intronic
902588853 1:17459116-17459138 TGGAAAACTGAGGCCCAGAGAGG + Intergenic
902634997 1:17729206-17729228 TGGGGGAAGGGGACCCAGTGAGG + Intergenic
902635850 1:17734772-17734794 TGGAAAACTGAGGCCCAGAGAGG + Intergenic
902650901 1:17836989-17837011 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
902696050 1:18141660-18141682 AAGGAAATGGAGGCCCAGAGAGG - Intronic
902743828 1:18459696-18459718 TGCAGAAAGGAGAGCCAGAGTGG - Intergenic
902758516 1:18565532-18565554 TAGGCAGAAGAGGCCCAGAGAGG - Intergenic
902782041 1:18711230-18711252 GAGGAAAAGGAAGCCCAGAGAGG - Intronic
902820351 1:18939442-18939464 GGGGAAACTGAGGCCCAGAGAGG - Intronic
902844484 1:19099130-19099152 TGGGGAATGGAGGCTCAAACAGG - Intronic
902934271 1:19753412-19753434 TGAAGAAATGAGGCACAGAGAGG + Intronic
902938671 1:19783806-19783828 GGAGAAACGGAGGCCCAGAGAGG + Intronic
903014111 1:20350766-20350788 GGGGGAACAGAGGCCTAGAGAGG - Intronic
903016401 1:20364920-20364942 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
903022048 1:20401466-20401488 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
903354107 1:22736018-22736040 TGGGGAACTGAGGCTCAGAGAGG - Intronic
903355876 1:22747046-22747068 GGGGAAACTGAGGCCCAGAGAGG + Intronic
903356040 1:22748090-22748112 TGGGGAAACTAAGGCCAGAGAGG - Intronic
903364086 1:22795155-22795177 AGAGGAACCGAGGCCCAGAGAGG + Intronic
903367859 1:22816034-22816056 GGGGAAAAGAAGGCCCAGAGAGG - Intronic
903473318 1:23602527-23602549 TGGGTAACTGAGGCTCAGAGAGG - Intronic
903589654 1:24445004-24445026 TAGGAAAGGGAGGCTCAGAGAGG - Intronic
903607224 1:24583915-24583937 TAGGAAACGGAGGCTCAGAGAGG - Intronic
903677553 1:25073929-25073951 TGGGCAACTGAGGCCCAGAGAGG - Intergenic
903705046 1:25279552-25279574 GGGGAAAGGGAGGCACAGAGAGG - Intronic
903722182 1:25413769-25413791 GGGGAAAGGGAGGCACAGAGAGG + Intronic
903747188 1:25595546-25595568 TGGGAAAAGAAGACCCAGGGAGG - Intergenic
903809217 1:26025427-26025449 TGGAAAACTGAGGCCCAGAGAGG + Intronic
903852616 1:26317322-26317344 TGAGGAACTGAGGCCTAGAGAGG + Intronic
903870308 1:26429283-26429305 TGGGGTCAGGAGGCCAAGAAAGG + Exonic
903895467 1:26600546-26600568 TGGAGAAAGGAAGACCAGATAGG + Intergenic
903943351 1:26946522-26946544 TGAGAAACTGAGGCCCAGAGAGG - Exonic
903999656 1:27331756-27331778 GGAGAAAATGAGGCCCAGAGAGG + Intronic
904033174 1:27545835-27545857 GGGGAAACTGAGGCCCAGAGAGG + Intronic
904058202 1:27686140-27686162 TGAGGGCAGGAGGCCCAGGGAGG + Intergenic
904246942 1:29194532-29194554 AGGCCAGAGGAGGCCCAGAGAGG + Intronic
904355127 1:29933810-29933832 TGAGTACAGGAGGCTCAGAGAGG - Intergenic
904370600 1:30045399-30045421 GGGGAAAAGGAGGAGCAGAGAGG + Intergenic
904422458 1:30403062-30403084 GAGGGAACCGAGGCCCAGAGAGG + Intergenic
904426588 1:30427744-30427766 GGGGGAAGGGTGTCCCAGAGGGG - Intergenic
904431941 1:30470006-30470028 GGGGAAACGGAGGCCCAGAGAGG - Intergenic
904434572 1:30485894-30485916 TGGGAAACTGGGGCCCAGAGTGG - Intergenic
904437679 1:30509211-30509233 TGGGAAATTGAGGCACAGAGAGG + Intergenic
904451837 1:30618234-30618256 GGGGGAATGGAGGCCCAGAGAGG - Intergenic
904458361 1:30660884-30660906 TGAGGAAATGAGGCTCAAAGAGG - Intergenic
904472896 1:30746766-30746788 TGAGGAGCCGAGGCCCAGAGAGG - Intronic
904500662 1:30910957-30910979 TGGGAAATTGAGGCTCAGAGAGG - Intergenic
904688007 1:32274556-32274578 AAAGGAAAAGAGGCCCAGAGAGG + Intronic
904690452 1:32289877-32289899 AGGGAAATGGAGGCCCAGAATGG + Intergenic
904706080 1:32392009-32392031 TGAGGAACTGAGGCCTAGAGAGG + Intronic
904774966 1:32901054-32901076 GGGGAAACTGAGGCCCAGAGAGG + Intronic
904777843 1:32922427-32922449 TGGGGAAAGGTGGCCGGGCGCGG + Intergenic
904796732 1:33062012-33062034 TGGGGAACTGAGACCCAAAGAGG + Intronic
904833600 1:33320917-33320939 TGGGGAAAGGTGGCTCCGAGAGG - Intronic
904908469 1:33915953-33915975 GAGGAAAATGAGGCCCAGAGAGG - Intronic
904964063 1:34358121-34358143 TGGGGAATCTAGGCACAGAGAGG + Intergenic
905027400 1:34860149-34860171 AGGGGAAGGGAGGCTCAGACAGG - Intergenic
905031687 1:34888302-34888324 TGGGCAAACAAGACCCAGAGAGG + Intronic
905123674 1:35702318-35702340 GGGGGAAAGGAGGCTCAGAAAGG + Intergenic
905165723 1:36082078-36082100 GGGGGAAAGAAGTCCCAGAAGGG - Intergenic
905227323 1:36487823-36487845 TGGGAAGCTGAGGCCCAGAGAGG + Intergenic
905266977 1:36761051-36761073 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
905281526 1:36852452-36852474 TGTGGAAACGAGGCCCAGAAGGG + Intronic
905283856 1:36866677-36866699 TGAGAAAATGAGGCACAGAGAGG + Intronic
905528444 1:38657065-38657087 GCTGGAAAAGAGGCCCAGAGAGG + Intergenic
905879380 1:41453779-41453801 GGGAGAACCGAGGCCCAGAGAGG - Intergenic
905885416 1:41489236-41489258 TGAAGAAACGAGGCTCAGAGAGG + Intergenic
905925776 1:41748676-41748698 TGGAGGCAGGAGGCTCAGAGAGG + Intronic
905967836 1:42114236-42114258 AAGGAAATGGAGGCCCAGAGAGG - Intergenic
906141160 1:43534365-43534387 TGGAGACAGGATGCCCAGTGGGG + Intronic
906612509 1:47213224-47213246 GGAGGAAATGAGGCCTAGAGGGG - Intergenic
906652450 1:47522338-47522360 AGGGAAACAGAGGCCCAGAGAGG + Intergenic
906791377 1:48661243-48661265 TGGGCCAGGGAGGCCCACAGTGG + Intronic
906802654 1:48751087-48751109 TGGACAACTGAGGCCCAGAGAGG - Intronic
906912774 1:49972967-49972989 GGAGGAAATCAGGCCCAGAGAGG + Intronic
906948782 1:50317736-50317758 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
907020282 1:51060177-51060199 TGGGGAGAGGAGACCTGGAGTGG - Intergenic
907044882 1:51294598-51294620 GGGGAAACTGAGGCCCAGAGAGG - Intronic
907215121 1:52856525-52856547 GAGGAAAATGAGGCCCAGAGAGG + Intronic
907240900 1:53080553-53080575 TGGGAAATAGAGGCTCAGAGAGG - Intronic
907273160 1:53302454-53302476 CGGGGCACTGAGGCCCAGAGAGG + Intronic
907317371 1:53581038-53581060 TTGGAAACTGAGGCCCAGAGAGG - Intronic
907323628 1:53621105-53621127 AAGGGAATGGAGGCACAGAGAGG - Intronic
907359943 1:53906304-53906326 TGGGGACAGGGGGCCCAGGGAGG + Intronic
907363905 1:53944871-53944893 TGGGGAAAGAAGGACCACAAAGG - Intronic
907387042 1:54132835-54132857 TAGGAAATGGAGGCTCAGAGAGG + Intergenic
907472323 1:54681919-54681941 TGAGGAATTGAGGCTCAGAGAGG - Intronic
907499517 1:54868023-54868045 TAAGGAAATGAGGCCCAGAAAGG - Intronic
907552625 1:55317263-55317285 TGAGGAAACGAGTCTCAGAGAGG + Intergenic
907674653 1:56507327-56507349 TGAGGAAACTAGGCCCAGAAGGG + Intronic
907841744 1:58165026-58165048 TGTGGAAATGGGGCCTAGAGTGG - Intronic
907885904 1:58592126-58592148 TGGGAAACTGAGGCTCAGAGGGG + Intergenic
908076346 1:60523614-60523636 TAAGGAAAGTAGGTCCAGAGAGG - Intergenic
908317120 1:62943687-62943709 TAGGGAACTGAGACCCAGAGAGG + Intergenic
908473090 1:64463630-64463652 AGGGAAAAGGAGGCTCAGAAAGG - Intergenic
908564545 1:65341046-65341068 TGCAGAAATGAGGCTCAGAGAGG - Intronic
908784434 1:67721275-67721297 TGAAGGAAGGAGCCCCAGAGTGG + Intronic
908789405 1:67766835-67766857 GGGGGAAGCGAGGCCCAGCGAGG - Intronic
908921672 1:69201710-69201732 TGGGGAAAGGAGGAGTAGAGTGG - Intergenic
909144218 1:71908551-71908573 TGAAGAAAGGAGGCTCTGAGAGG + Intronic
909329332 1:74393725-74393747 TGGGGGATGGGGGCCCTGAGGGG + Intronic
909353557 1:74681411-74681433 TAGGGAAAGGAAGTCGAGAGGGG + Intergenic
909599667 1:77448389-77448411 AGCGGAGAGGAGACCCAGAGTGG - Intronic
910294172 1:85628003-85628025 AGGGGCAAGTAGGACCAGAGAGG - Intergenic
911209003 1:95120000-95120022 TGGACAAAGGAGGGCCAGACTGG + Intronic
911646284 1:100340564-100340586 TAGGAAAATGAGGCACAGAGAGG + Intergenic
911648617 1:100361902-100361924 TGGGGAAAGAAAGGCCAGATGGG + Intronic
912369184 1:109160035-109160057 TGGGAAAAATAGACCCAGAGAGG + Intronic
912466417 1:109877800-109877822 TGGGGCAGGGAGGTCCTGAGGGG - Intergenic
912513761 1:110205618-110205640 GGGGAAACGGAGGCCCAAAGAGG + Intergenic
912701511 1:111881722-111881744 AGGGGAACTGAGGCCCAGAGAGG - Intronic
912887674 1:113492472-113492494 TGGAAAAAGGATGCCAAGAGAGG - Intronic
913042167 1:115037713-115037735 TTGTGAAAGGAGGGCCAGTGTGG + Intergenic
913089218 1:115465296-115465318 TGGGAAACTGAGGCCCAGAGTGG + Intergenic
913259812 1:116987895-116987917 TGGGGCCAGGAGGGTCAGAGTGG + Exonic
913974299 1:143442228-143442250 TTGGGAAAGCATGCCCAGTGTGG - Intergenic
913974352 1:143442600-143442622 TTGGAAAAGGAGGCTGAGAGAGG - Intergenic
914068688 1:144267842-144267864 TTGGGAAAGCATGCCCAGTGTGG - Intergenic
914068742 1:144268214-144268236 TTGGAAAAGGAGGCTGAGAGAGG - Intergenic
914110413 1:144698140-144698162 TTGGAAAAGGAGGCTGAGAGAGG + Intergenic
914110467 1:144698512-144698534 TTGGGAAAGCATGCCCAGTGTGG + Intergenic
914938661 1:152002982-152003004 TGTGGAAAGGAAGCTCAGAGAGG + Intergenic
915020943 1:152777816-152777838 TGTGGAAGGGAGGACCAAAGTGG + Intronic
915087619 1:153398804-153398826 GGGGGAAATGAAACCCAGAGAGG + Intergenic
915145198 1:153792724-153792746 TGGGACGAGGAGGCCCCGAGGGG + Intergenic
915287425 1:154861861-154861883 CAGAGAAACGAGGCCCAGAGAGG + Intronic
915593814 1:156885102-156885124 CGGGGCAAGGAGGGGCAGAGAGG + Intergenic
915617482 1:157050711-157050733 GGGGAAACAGAGGCCCAGAGAGG + Intergenic
915941021 1:160118131-160118153 TGGGAAAAGGAGGCACTGCGTGG + Intronic
915973671 1:160371160-160371182 GGTGGAAAGGGGCCCCAGAGAGG - Exonic
916203897 1:162297147-162297169 TGAGGAAAGCAGCCCCAAAGAGG - Intronic
916238984 1:162620349-162620371 CAGGGAAAAGAGGCACAGAGAGG + Intergenic
916463957 1:165054467-165054489 TGGGGAAAGGAGACACAAAGAGG + Intergenic
916486517 1:165264664-165264686 TAGGAAAAGGAGGCCTAGTGCGG + Intronic
917082066 1:171265869-171265891 TAGAGAAAGGAGGCTCACAGAGG + Intronic
917564612 1:176200100-176200122 TGAGGAAATGTGGCCCATAGAGG - Intronic
917600844 1:176572052-176572074 TGGGGCAGTGAGACCCAGAGAGG + Intronic
917643503 1:177007076-177007098 TGGGAAAGGGAGAGCCAGAGAGG - Intronic
917740907 1:177961337-177961359 TTGGGAAAGGAGGCACTCAGTGG - Intronic
917839575 1:178966726-178966748 TGAGGAACCAAGGCCCAGAGAGG - Intergenic
919723944 1:200870052-200870074 TGGGGCAAGCAGACCAAGAGGGG - Intergenic
919869899 1:201812429-201812451 TGGGGAAAGTGGGGTCAGAGTGG - Intronic
920052990 1:203174698-203174720 GGGGAAAATGAGGCCCAGAGAGG - Intronic
920092533 1:203464693-203464715 TGGGGGAATGAGGCACAGTGGGG + Intergenic
920305565 1:205016130-205016152 AGGGAAATGGAGGCCTAGAGAGG - Intronic
920440750 1:205979045-205979067 TGGGAAACTGAGGCCCAGACAGG + Intronic
920506767 1:206520712-206520734 TGGAAAAATGAGGCTCAGAGAGG - Intronic
920917668 1:210271102-210271124 TGGGAAACGGAGGCTCAGAGGGG - Intergenic
921262458 1:213396196-213396218 TAGGGAACAGAGGCCCAGAGAGG - Intergenic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
921293935 1:213684316-213684338 TGAGGAACTGAGGCCCAGAGAGG + Intergenic
921599677 1:217093230-217093252 TAGGGAACTGAGGCCCAGAATGG - Intronic
921921396 1:220674241-220674263 TGGGGAGAGGAGGATCAGAGAGG + Intergenic
922163141 1:223093034-223093056 AGGGGAGAGGAGGATCAGAGAGG - Intergenic
922176263 1:223200428-223200450 TGGGGAAGGGAAGCCGCGAGGGG - Intergenic
922461945 1:225820031-225820053 TGAAGAAAGGTGGCCCAGACAGG - Intronic
922570981 1:226634626-226634648 GGAGGAAAGGAGGCCCAGGCGGG + Exonic
922890496 1:229058306-229058328 CAGGGAATAGAGGCCCAGAGAGG + Intergenic
923039364 1:230308789-230308811 AGGGGAAATGAGGCCCAGAAAGG + Intergenic
923151973 1:231241466-231241488 CAGGGAAAAGAGGCCCAGAGCGG + Intronic
923270645 1:232352380-232352402 TCAGGAAGGCAGGCCCAGAGCGG + Intergenic
923674343 1:236066623-236066645 AGGGGCATAGAGGCCCAGAGAGG + Intergenic
924239768 1:242029930-242029952 AAGAGAAAGGAGGCACAGAGAGG + Intergenic
1062916035 10:1241828-1241850 TGGGGAACCGAGGCCAGGAGAGG + Intronic
1063975860 10:11415114-11415136 TTGGGAAAAGTGGCCCACAGTGG - Intergenic
1064327396 10:14364023-14364045 TGGGGAAAGGAAGCCCAGAGTGG - Intronic
1064652075 10:17519569-17519591 TGTGAAAAGGAGGCCAAGGGAGG + Intergenic
1064725108 10:18271230-18271252 TCGGGAAAAGAGGCCAAAAGAGG - Intronic
1064738271 10:18406221-18406243 TGGGGAAGGGAGGGATAGAGAGG + Intronic
1065174198 10:23061186-23061208 TGAGAAAACAAGGCCCAGAGAGG - Intergenic
1066335758 10:34476566-34476588 TTAGGGATGGAGGCCCAGAGAGG - Intronic
1066654847 10:37687752-37687774 AGGAGAAAGGAAGCCCAAAGAGG + Intergenic
1067025289 10:42838737-42838759 TAGGGGAAGGAGGCACAGAGAGG + Intergenic
1067039800 10:42943222-42943244 AGGAGAAAGGAGGACCAAAGAGG + Intergenic
1067535080 10:47103133-47103155 TGGGAAATGGAGACGCAGAGGGG - Intergenic
1068571838 10:58638479-58638501 TGGGGAAAGGAGCCTGAGACAGG - Intronic
1068965750 10:62910886-62910908 TGGGGAGAGTAGTACCAGAGAGG + Intronic
1068971426 10:62962341-62962363 AGGGGAAATGAGGACCAGTGGGG + Intergenic
1069557226 10:69406388-69406410 TGAGGAAATGAGTCCCAGAGAGG - Intronic
1069558333 10:69412495-69412517 TAGGAAACTGAGGCCCAGAGAGG + Intronic
1069571032 10:69494623-69494645 TGGGAAGCTGAGGCCCAGAGAGG + Intronic
1069772215 10:70907220-70907242 GGGGTAACTGAGGCCCAGAGAGG - Intergenic
1069773645 10:70914627-70914649 TAGGCAATGGAGGCCCAGAGAGG - Intergenic
1069800971 10:71081233-71081255 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1069827716 10:71264406-71264428 AAGGAAATGGAGGCCCAGAGAGG + Intronic
1069844254 10:71359713-71359735 AGGAGGAAGCAGGCCCAGAGAGG + Intronic
1069869198 10:71522923-71522945 TGGGGAAAAAACACCCAGAGAGG + Intronic
1069872845 10:71543677-71543699 TGGGAAACTGAGGCCCAGATGGG + Intronic
1069914579 10:71779559-71779581 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1069943180 10:71969272-71969294 TGAGGACATGAGGCTCAGAGAGG + Intronic
1069954813 10:72043452-72043474 TGGGGAAAGGAGGAGAAGAGGGG + Intergenic
1070375497 10:75827109-75827131 TTGGAAATGGGGGCCCAGAGAGG - Intronic
1070594191 10:77821038-77821060 TGGGGAGGGGAGGCCTAGAGAGG - Intronic
1070630533 10:78081605-78081627 TGGCCACAGGAGGACCAGAGTGG + Intergenic
1070681442 10:78451944-78451966 TGGGGAAAGACAGCCCAGAAGGG - Intergenic
1070705707 10:78636472-78636494 TATGGAACGGAGGCCCAGAGAGG + Intergenic
1070760917 10:79023932-79023954 AGAGGAAACAAGGCCCAGAGAGG + Intergenic
1070819443 10:79346478-79346500 TGGGAAACTGAGGCCCAGAGAGG + Intergenic
1071088189 10:81888603-81888625 TAGAGAAGGGAGGCCCAGGGAGG + Intronic
1071542738 10:86502738-86502760 TGAGAAAAAAAGGCCCAGAGGGG + Intronic
1071564611 10:86665286-86665308 TGGGGACAGGAAGCCCTGGGAGG + Intronic
1072200333 10:93152051-93152073 TGGGGAAATGAGGCTCAGAGAGG + Intergenic
1072217422 10:93299267-93299289 GAGGGAAAGGAGCCCCCGAGGGG + Intergenic
1072411078 10:95202594-95202616 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1072555392 10:96510955-96510977 TAAGGAACTGAGGCCCAGAGAGG + Intronic
1072719152 10:97770390-97770412 AAGGGAACCGAGGCCCAGAGCGG + Intronic
1072871277 10:99123897-99123919 AGTGGAGAGGAGACCCAGAGTGG + Intronic
1073149980 10:101304992-101305014 TGGGGAAGGGGGTCCCAGGGTGG - Intergenic
1073327070 10:102649345-102649367 TGGGGAAAGGAGGGAAAGATGGG + Intronic
1073428506 10:103471120-103471142 TGGGGAAAGGAGGCTCAGGGAGG - Intergenic
1073764129 10:106663415-106663437 TGGGGAAAGGGGGCCAGGATTGG + Intronic
1074585128 10:114761137-114761159 TTGGGACAAGAGGCCCAGAGTGG + Intergenic
1074703073 10:116109547-116109569 CGGGGAAGGGGTGCCCAGAGAGG - Intronic
1074859277 10:117497998-117498020 GGGGGAGCTGAGGCCCAGAGAGG + Intergenic
1075068656 10:119306495-119306517 TGTGAAATGGAAGCCCAGAGTGG + Intronic
1075125467 10:119695470-119695492 AGTGGAGAGGAGACCCAGAGGGG + Intergenic
1075556533 10:123436369-123436391 TGTGGGAAGGAGGCACACAGTGG - Intergenic
1075726713 10:124614313-124614335 GGGGAAACTGAGGCCCAGAGGGG + Intronic
1075739524 10:124685823-124685845 TGGAGTAGGGAGGCCCTGAGGGG - Intronic
1075803974 10:125172060-125172082 GAAGAAAAGGAGGCCCAGAGAGG - Intergenic
1075864267 10:125704296-125704318 TGGTCAGAGGAGGGCCAGAGTGG - Intergenic
1076005391 10:126944585-126944607 CGGGGAGCGGAGGCCCAGGGAGG + Intronic
1076469011 10:130705654-130705676 TGGGGAACGGAGACCCTGGGTGG - Intergenic
1076520501 10:131078098-131078120 TGGGGCCAGGAGGCACAGGGTGG - Intergenic
1076727127 10:132419185-132419207 TGAGGAGCGGAGGCCCAGGGAGG + Intergenic
1076881070 10:133239494-133239516 TGCGGAAAGGGGGCTCAGAGAGG - Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077424051 11:2466228-2466250 GGGGAAACTGAGGCCCAGAGTGG + Intronic
1077431696 11:2518875-2518897 TGGGCCAAGGAGGCCCAGTCTGG + Intronic
1077479689 11:2807775-2807797 TGGGGGAAAGAGGCAGAGAGAGG - Intronic
1077491277 11:2862180-2862202 TGGGGAATACCGGCCCAGAGGGG + Intergenic
1077556946 11:3230474-3230496 TGGGGAGAGGTGGCCCGGGGCGG + Intronic
1077560966 11:3260772-3260794 TGGGGAATGGAAGGCCAGAGTGG - Intergenic
1077566863 11:3306602-3306624 TGGGGAATGGAAGGCCAGAGTGG - Intergenic
1078359560 11:10657849-10657871 TGGGGAACCGAGGCCCAGAGGGG + Intronic
1078571311 11:12460336-12460358 GAGGAAAATGAGGCCCAGAGAGG - Intronic
1078582261 11:12547602-12547624 TGGGAATAGAAGGCTCAGAGTGG + Intergenic
1078868977 11:15326561-15326583 TGAGGAAAATAGGCCCAGAGAGG - Intergenic
1079075341 11:17382183-17382205 TGGGGAAAGGAAGAACAGTGGGG - Intergenic
1079076908 11:17389676-17389698 CCGGGAAAGGAGGCGCTGAGAGG + Intergenic
1079085962 11:17445109-17445131 TGGGTATCAGAGGCCCAGAGAGG - Intronic
1079091703 11:17485259-17485281 TAGGAAACTGAGGCCCAGAGAGG + Intergenic
1079111786 11:17609396-17609418 AGGAGAAATGAGGCCCAGAGTGG + Intronic
1079282284 11:19098245-19098267 TGAGGAAAAGGGGCTCAGAGAGG - Intergenic
1079291319 11:19190788-19190810 TGGGTAGAAGAGCCCCAGAGAGG - Intronic
1079298002 11:19251789-19251811 GGGGGAAAGGAGGTTCAGAGAGG - Intergenic
1079430376 11:20383977-20383999 TGGGGAAATGAGGCTCACTGTGG + Intergenic
1079449735 11:20589488-20589510 TGGGGAAAGGAGGCTGAGATGGG - Intergenic
1079797583 11:24825416-24825438 TGGGGAAAGCAGGAGGAGAGAGG - Intronic
1079818110 11:25088801-25088823 GCGGGAAATGAGGCCAAGAGAGG - Intergenic
1079931926 11:26574008-26574030 TGGAGAAAGGAGGTCTAAAGTGG - Intronic
1080815362 11:35750885-35750907 TGGGAAAAGGAGGCCCAGAGAGG + Intronic
1081495890 11:43609796-43609818 TGGGGAAACCAGTTCCAGAGAGG - Intronic
1081517088 11:43843611-43843633 TGGGGAAAGGATGCCAACAGAGG - Intronic
1081528234 11:43941725-43941747 TGGGAAAACCAGGCACAGAGGGG - Intronic
1081584160 11:44372693-44372715 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1081638732 11:44738429-44738451 TGGGAAAATGAGGCACAGAGAGG - Intronic
1081649189 11:44812252-44812274 CAGGGAACTGAGGCCCAGAGAGG - Intronic
1081655616 11:44855543-44855565 GAGGGAACTGAGGCCCAGAGAGG + Intronic
1081656145 11:44858755-44858777 TGGGGAGGAGAGGCCAAGAGTGG + Intronic
1081789958 11:45775536-45775558 AGGGGAAGGGAGGCAGAGAGGGG - Intergenic
1081847898 11:46253739-46253761 TCTGGCAAGGAGGCTCAGAGAGG - Intergenic
1081863724 11:46348218-46348240 TGGTGCCAGGAGGCTCAGAGAGG - Intronic
1081869831 11:46378270-46378292 TGGGGGCAGGAGGCTCAGTGGGG + Intronic
1081907321 11:46678211-46678233 GTGGGAAAGGAGGCCAAGAGGGG + Exonic
1081942410 11:46955230-46955252 TGGGGTCAGGAGGCCAAGAAAGG - Intronic
1082268122 11:50141665-50141687 GGGGAAAGTGAGGCCCAGAGAGG + Intergenic
1082287954 11:50336853-50336875 GGGGAAAGTGAGGCCCAGAGAGG - Intergenic
1082869965 11:57935234-57935256 GTGGGAAAAGAGGCCCAGAGAGG + Intergenic
1083144398 11:60748117-60748139 GGGGAAACCGAGGCCCAGAGAGG - Intergenic
1083363816 11:62129386-62129408 TGAGGAACGGAGGCTCAGAGAGG - Intronic
1083678252 11:64339971-64339993 TGAGAAAACAAGGCCCAGAGAGG + Intergenic
1083759770 11:64809515-64809537 TGGGAAACTGAAGCCCAGAGAGG - Intronic
1083804940 11:65067857-65067879 TGCAGAGAGGAGGCCCAGAGAGG - Intronic
1083878996 11:65539093-65539115 TGGGGAACGCAGGCCCCGTGCGG + Exonic
1083897997 11:65629871-65629893 TGGGAAACGCAGGCCCAGGGAGG - Intronic
1084105327 11:66976885-66976907 GGGGAAACTGAGGCCCAGAGTGG + Exonic
1084275016 11:68046939-68046961 GGGGAAATGGAGGCTCAGAGAGG + Intronic
1084345300 11:68543159-68543181 TTGGAAACTGAGGCCCAGAGAGG + Intronic
1084435389 11:69136488-69136510 TGGGGAACCAAGACCCAGAGAGG + Intergenic
1084459661 11:69289518-69289540 GGGGAACGGGAGGCCCAGAGAGG + Intergenic
1084473645 11:69376889-69376911 TGGGGGCTGGTGGCCCAGAGGGG + Intergenic
1084547760 11:69822831-69822853 TGAGAAAGGGAGGCTCAGAGAGG + Intergenic
1084609470 11:70193110-70193132 TGGGCACAGGAGGCTCAGAGAGG + Intergenic
1084718915 11:70891710-70891732 TGGGGGATGGAGACCGAGAGAGG - Intronic
1084770093 11:71337030-71337052 TGGGAAAAGGAGGCTGAGACTGG + Intergenic
1084892293 11:72242568-72242590 TGGAGAAATGAGGCCCAGGGTGG - Intronic
1085026592 11:73240064-73240086 GGGGAAAGCGAGGCCCAGAGAGG - Intergenic
1085157710 11:74311543-74311565 TCGGGACAGGAGACCCAGAAAGG - Exonic
1085203965 11:74719157-74719179 TAGACAAATGAGGCCCAGAGAGG + Intronic
1085258200 11:75189052-75189074 GGGGAAACGGAGGCCCAGAAAGG - Intronic
1085270020 11:75264771-75264793 TGAGAAACTGAGGCCCAGAGTGG + Exonic
1085301426 11:75461139-75461161 GGGGAAATGGAGGCCCAGAGAGG - Intronic
1085328464 11:75626922-75626944 GGAGGTGAGGAGGCCCAGAGTGG + Intronic
1085388595 11:76170970-76170992 AGGGAAAATGAGGCCCAGAGAGG + Intergenic
1085405676 11:76260374-76260396 TGAGGCAAGGAGGCACAGATAGG - Intergenic
1085471597 11:76761859-76761881 TGAGGAAGCGAGGCCCAGGGTGG + Intergenic
1085475972 11:76789106-76789128 TGGGCAACTGGGGCCCAGAGAGG - Intronic
1085496913 11:76978418-76978440 AGTGGAGAGGAGACCCAGAGTGG - Intronic
1085514081 11:77102375-77102397 TGGAGAAGGCAGGACCAGAGAGG - Intronic
1085528122 11:77175769-77175791 TGGGAAAATGAGGCTCAGAAAGG - Intronic
1085619933 11:78030424-78030446 TGGAGAACTGAGGCCCAGAGAGG - Intronic
1085693983 11:78688442-78688464 TAGGGAAGGGAGACTCAGAGAGG - Intronic
1085773967 11:79349026-79349048 GGAGGAAAGGAGGCTCAAAGGGG + Intronic
1085806168 11:79638473-79638495 TGGGGAACTGAGGTCCAGGGTGG - Intergenic
1085842633 11:80030036-80030058 TTGGGAAAAGAAGCCCAGAAAGG - Intergenic
1087014184 11:93540349-93540371 TGTGGAAACCAGGCTCAGAGAGG + Intronic
1087212061 11:95454626-95454648 AGGGGAAAGCAAGCCTAGAGCGG - Intergenic
1087212663 11:95459445-95459467 AGTGGACAGGAGGCCCAGACAGG + Intergenic
1087407853 11:97752171-97752193 AGTGGAGAGGAGGCCCACAGTGG + Intergenic
1087799414 11:102487717-102487739 TGGTTATAGGAGGGCCAGAGTGG + Intronic
1088328789 11:108628988-108629010 AGTGGGAAGGAGACCCAGAGTGG + Intergenic
1088505221 11:110520948-110520970 AGGGAAAGGAAGGCCCAGAGAGG + Intergenic
1088679338 11:112226096-112226118 GTGGGAGAGGAGGCTCAGAGAGG + Intergenic
1088707309 11:112475505-112475527 TGAGAAAATAAGGCCCAGAGGGG - Intergenic
1089085081 11:115810076-115810098 TGGGGAAAAGAGGCACAAAAAGG + Intergenic
1089146205 11:116331181-116331203 GGGGCAACTGAGGCCCAGAGAGG - Intergenic
1089185772 11:116613781-116613803 GGGGGCAAGGTTGCCCAGAGTGG - Intergenic
1089293320 11:117451452-117451474 AGGGAAACGGAGGCTCAGAGAGG - Intronic
1089309997 11:117551691-117551713 TGGGGAAAGGGGGTCTGGAGGGG + Intronic
1089412867 11:118261862-118261884 TGAGGAAACGAGGCTCACAGAGG - Intronic
1089610621 11:119666647-119666669 TGGAGCAAGGAGGGCCTGAGCGG - Intronic
1089616903 11:119699927-119699949 GGGGGAACAGAGACCCAGAGAGG - Intronic
1089630513 11:119781367-119781389 TGAGAAAGTGAGGCCCAGAGGGG + Intergenic
1089711117 11:120315387-120315409 TGTGGACAGGAGGGACAGAGAGG - Exonic
1090069194 11:123528827-123528849 AGGGAAATGGAGGCACAGAGTGG + Intronic
1090413872 11:126527554-126527576 TGGGAAAATGAGGCACAGGGAGG + Intronic
1090416823 11:126546280-126546302 TGGGAAATGGAGGCCCAGTGAGG + Intronic
1090942227 11:131396914-131396936 AAGGGAAATGAGGCCCAGAGAGG - Intronic
1090989812 11:131806593-131806615 TGGGGTAATGAGGCCCAGAAAGG + Intronic
1091215428 11:133898569-133898591 TGGGGATAGAGGGCCCAGAAGGG - Intergenic
1091483435 12:858737-858759 TAGGAAATGGAGGCCCAGAAAGG - Intronic
1091602410 12:1925741-1925763 GGGGAAACTGAGGCCCAGAGCGG - Intergenic
1091714701 12:2768595-2768617 TGAGAAAAGGAGGTCCAGAAAGG + Intergenic
1091721216 12:2815442-2815464 AGGGCACTGGAGGCCCAGAGTGG + Intronic
1091787785 12:3253412-3253434 ATGAGAAACGAGGCCCAGAGAGG - Intronic
1091795270 12:3294425-3294447 TGGAGAAAGAAGGCAGAGAGGGG + Intergenic
1092069141 12:5618484-5618506 AAGGGAATTGAGGCCCAGAGAGG + Intronic
1092123148 12:6058317-6058339 TGGAGAAGGGAGGCCCAAAGAGG + Intronic
1092136191 12:6149219-6149241 TGGGTAAAAGAGTGCCAGAGAGG - Intergenic
1092156086 12:6282360-6282382 TGGGTGGAGGAGGCACAGAGTGG - Intergenic
1093166375 12:15808402-15808424 TGAGAAAATGAGGCACAGAGAGG + Intronic
1093372065 12:18377234-18377256 TGAGGAAATGGGGCCCAAAGAGG + Intronic
1093906200 12:24694700-24694722 GGGGGAACTGAGGCACAGAGAGG + Intergenic
1094240165 12:28213148-28213170 GGGGGAAAGGAGGGGCAGAGGGG - Intronic
1094831338 12:34301648-34301670 AGTGGAAAGAAGGCCCAGAAGGG + Intergenic
1094834222 12:34314707-34314729 AGAGGCAAGAAGGCCCAGAGAGG - Intergenic
1094836952 12:34326553-34326575 AGCGGAAAGAAGGCCCAGAAAGG - Intergenic
1094837652 12:34329672-34329694 TGTGGCAAGGAGGCCCAGAAGGG - Intergenic
1094838082 12:34331571-34331593 TGCGGCAAGAAGGCCCAGAAGGG - Intergenic
1096077514 12:48814675-48814697 TGGAGAAAGGAGGGGGAGAGGGG + Intronic
1096087330 12:48874529-48874551 TAGGGAATGGAAGCACAGAGAGG + Intergenic
1096388102 12:51208496-51208518 TGGTGAAACAAAGCCCAGAGGGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096444006 12:51672153-51672175 TGGGGACAGGAGGTCAAGTGAGG - Intronic
1096457055 12:51796226-51796248 TGAGGAACTGAGGCACAGAGAGG + Intronic
1096458898 12:51811192-51811214 TGGGGAAAGGAGGGGAATAGAGG + Exonic
1096642693 12:53006763-53006785 TTGGGGAAGGAGGCGCAGAAAGG + Intronic
1096692935 12:53332266-53332288 TGGGGGAAGGAGGACCTGAGAGG + Intronic
1097153943 12:56999236-56999258 TAGGGAAAAGAGTCCCAGATGGG + Exonic
1097712466 12:62932247-62932269 GCGGAAATGGAGGCCCAGAGAGG + Intronic
1097746404 12:63308700-63308722 TTGGGAAAGGAGCCCCTGTGAGG - Intergenic
1097788464 12:63787842-63787864 TGGGGACAGGAGTCCGAGACAGG - Intronic
1097900024 12:64863312-64863334 GAGGAAAAGGAAGCCCAGAGAGG + Intronic
1098180603 12:67842192-67842214 AGGGAAATGGAGGCACAGAGAGG + Intergenic
1098245307 12:68511316-68511338 TGAGGATATGAGGCACAGAGAGG - Intergenic
1098292966 12:68976179-68976201 TGAGAAAACTAGGCCCAGAGAGG + Intergenic
1098878741 12:75894408-75894430 TAGGAAACGGAGGCACAGAGAGG + Intergenic
1099033765 12:77560321-77560343 AGCGGAGAGGAGACCCAGAGTGG - Intergenic
1099658989 12:85531243-85531265 TGAGGAAAGTAAGCACAGAGAGG - Intergenic
1100304606 12:93338807-93338829 CAGGAAAAGGAGGCTCAGAGCGG + Intergenic
1100382103 12:94071617-94071639 TGGACAATTGAGGCCCAGAGAGG - Intergenic
1100813345 12:98362152-98362174 TGGGAAAGAGAGACCCAGAGGGG + Intergenic
1101022944 12:100572473-100572495 TGGAGACCTGAGGCCCAGAGAGG + Intergenic
1101028292 12:100635311-100635333 TGGACACGGGAGGCCCAGAGGGG + Intergenic
1101794409 12:107959698-107959720 TGAGGAACTGAGGCTCAGAGAGG + Intergenic
1101819392 12:108172169-108172191 AGGGGAATGGATGACCAGAGAGG + Intronic
1101839906 12:108320656-108320678 TGGGGAGAGGAAGGCCAAAGTGG - Intronic
1101862675 12:108495763-108495785 TGAGGAATTGAGGCCCAGAGAGG + Intergenic
1101875849 12:108596659-108596681 TGGGAAACTGAGGCCCAGAGAGG - Intronic
1101890024 12:108705134-108705156 TGGGAAACTGAGGCTCAGAGAGG - Intronic
1101965228 12:109277867-109277889 GGGGAAATTGAGGCCCAGAGAGG - Intergenic
1101975249 12:109352369-109352391 TGGGGGAAGGAGGTGGAGAGTGG - Intronic
1102008575 12:109604291-109604313 GGGGACAATGAGGCCCAGAGAGG - Intergenic
1102015543 12:109645641-109645663 TGGGGGAAAGAGGCTCAGAAAGG - Intergenic
1102024814 12:109708410-109708432 GGGGACCAGGAGGCCCAGAGAGG - Intergenic
1102041644 12:109804818-109804840 TGGATAAAGGAAGGCCAGAGAGG - Intronic
1102169639 12:110832547-110832569 TGAGGAAATGAGGCCCAGAGAGG + Intergenic
1102177778 12:110888451-110888473 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1102219314 12:111183644-111183666 TGGAGAAGTGACGCCCAGAGAGG - Intronic
1102462795 12:113110272-113110294 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1102519663 12:113470643-113470665 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1102531909 12:113552982-113553004 TGAAGAAATGAGGCTCAGAGAGG - Intergenic
1102563999 12:113782869-113782891 GGGGAAACTGAGGCCCAGAGGGG + Intergenic
1102629694 12:114267020-114267042 TGGGAAACAGAGGCTCAGAGGGG - Intergenic
1103030369 12:117607527-117607549 TGGAGAAAGGGGGCCCATGGAGG - Intronic
1103168322 12:118790152-118790174 GGGGGATGTGAGGCCCAGAGAGG + Intergenic
1103245285 12:119451462-119451484 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1103249471 12:119487224-119487246 GGGGGATGGGAGGCTCAGAGAGG - Intronic
1103371321 12:120421728-120421750 TGGGAAACTGAGGCTCAGAGAGG + Intergenic
1103448454 12:121010443-121010465 TGGGTAACTGAGGCTCAGAGAGG - Intronic
1103782355 12:123407467-123407489 GAGGGGAAGGAGGGCCAGAGAGG - Intronic
1103915742 12:124374754-124374776 TAGGGCAAGGACACCCAGAGTGG - Intronic
1103943066 12:124511404-124511426 TGGAGAAACTAGGCCCAGAGAGG - Intronic
1104054267 12:125217314-125217336 TGGGAAACTGAGGCTCAGAGAGG - Intronic
1104055537 12:125227359-125227381 GGGGAAAATGAGGCACAGAGAGG + Intronic
1104153755 12:126110323-126110345 TGGGAAAATGAGGCACAGAGAGG - Intergenic
1104544976 12:129702491-129702513 TGGGGAGAGGGTGCCCAGAGAGG - Intronic
1104709596 12:130976322-130976344 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1104758769 12:131284678-131284700 TGGGGGAGGGAGGCTCAGAAGGG - Intergenic
1104821832 12:131681847-131681869 TGGGGGAGGGAGGCTCAGAAGGG + Intergenic
1104892440 12:132147110-132147132 TGGGACACGGAAGCCCAGAGTGG + Intronic
1105437709 13:20391553-20391575 TGGGGAAAGGAGGCGAGGGGTGG + Intergenic
1105502851 13:20988247-20988269 TGGAGTACGGAGGCCCAGACCGG - Exonic
1105817052 13:24045874-24045896 TAGGGAAATGAGGCTCAGAATGG - Intronic
1105940392 13:25142379-25142401 GGGGAAATTGAGGCCCAGAGAGG - Intergenic
1106016736 13:25876411-25876433 TGGGGAAAGGAGAGCAAGGGAGG + Intronic
1106504005 13:30355684-30355706 GGGAGAAAGGAGGCCAGGAGAGG - Intergenic
1106787064 13:33118101-33118123 TGGTGAAAAGAGGCTCAGGGAGG + Exonic
1107283551 13:38763798-38763820 TGGGGAAGGGAGGCGGAGAAGGG + Intronic
1107563355 13:41577201-41577223 TGGTCAGAGGAGGGCCAGAGTGG + Intronic
1107689932 13:42943494-42943516 TGAGGAAACGAGGCCCCAAGAGG + Intronic
1107861423 13:44664699-44664721 TGGGGGCAGGGGTCCCAGAGGGG + Intergenic
1107871736 13:44752923-44752945 CAGGAAATGGAGGCCCAGAGAGG + Intergenic
1108249632 13:48551417-48551439 AGTGGAGAGGAGACCCAGAGTGG - Intergenic
1108498964 13:51051523-51051545 GGGGAAAGAGAGGCCCAGAGAGG + Intergenic
1108573363 13:51771073-51771095 GAGGGAACTGAGGCCCAGAGAGG - Intronic
1108579286 13:51815043-51815065 TGGGGAAAGGAGGGTGGGAGAGG + Intergenic
1108709420 13:53017939-53017961 TGAGGAATGGAGCCCCATAGAGG - Intergenic
1108747055 13:53406640-53406662 TGGGAAACCAAGGCCCAGAGAGG + Intergenic
1109766108 13:66900253-66900275 TGGGAAAAGGAGACACTGAGAGG - Intronic
1109780792 13:67107463-67107485 AGTGGAGAGGAGGCCCAGAGTGG - Intronic
1110347005 13:74460338-74460360 TGGGAAATTGAGGCACAGAGGGG - Intergenic
1111376199 13:87381425-87381447 TGGGGTAAGGAGGCCAAGAAAGG + Intergenic
1112332524 13:98487476-98487498 TGGGTAATGGGGGCCCAGGGTGG - Intronic
1113503117 13:110793785-110793807 AGTGGAGAGGAGACCCAGAGTGG - Intergenic
1113509274 13:110839236-110839258 TGGGGAAGGGAGGGGAAGAGAGG - Intergenic
1113808309 13:113122664-113122686 TGGGGAAGGTGGGGCCAGAGTGG + Intergenic
1113977620 13:114241286-114241308 TAGGAAATGGAGGCCAAGAGAGG + Intronic
1114663501 14:24366041-24366063 TAGGGAAGGGAGGAGCAGAGGGG - Intronic
1115330302 14:32189666-32189688 TGGAGAAAGGAAGCCAGGAGAGG + Intergenic
1115469866 14:33757383-33757405 TGGGGAACTGAGGCTCATAGAGG + Intronic
1115724050 14:36193891-36193913 TGGAAGAAGGAGTCCCAGAGTGG - Intergenic
1116021686 14:39469212-39469234 TGGGGAGGGGAGGCGAAGAGAGG - Intergenic
1116448512 14:45039111-45039133 AGCGGAGAGGAGACCCAGAGTGG + Intronic
1117256010 14:53978443-53978465 AGGGGAAAGTTGTCCCAGAGAGG + Intergenic
1117339565 14:54781776-54781798 TGGGGCTAGGTGCCCCAGAGGGG - Intronic
1117495110 14:56294897-56294919 TGTGGAAGCCAGGCCCAGAGAGG + Intronic
1117616253 14:57536638-57536660 TAAGGAAATAAGGCCCAGAGAGG + Intergenic
1118258861 14:64229047-64229069 TGGGGAAAGCAGTCACAGACAGG + Intronic
1118590519 14:67397464-67397486 TGAGGAACGAAGGCTCAGAGAGG + Intronic
1118710727 14:68517253-68517275 AGGGGAAGGGAGGCAGAGAGGGG + Intronic
1118775450 14:68971172-68971194 AGGGAAATGGAAGCCCAGAGAGG - Intronic
1119053280 14:71391831-71391853 TGAGGAAAGAAGGCACAGGGAGG + Intronic
1119478166 14:74943012-74943034 TAGGAAACTGAGGCCCAGAGAGG + Intronic
1119485522 14:74984463-74984485 TGGGGAGGGGTGGCTCAGAGAGG + Intergenic
1119543177 14:75453645-75453667 TGAGGAATGGAGGCTCAGAGAGG + Intronic
1119773340 14:77235014-77235036 TAGGGAAAGGAGGGTGAGAGAGG - Intronic
1119861750 14:77940958-77940980 TTGGGAATTGAGGCCCAGAGAGG - Intergenic
1120664881 14:87294112-87294134 TTATAAAAGGAGGCCCAGAGAGG + Intergenic
1120755593 14:88241322-88241344 TGAGGAAACTAGGCTCAGAGAGG - Intronic
1120969817 14:90197967-90197989 GAGGAAACGGAGGCCCAGAGAGG + Intergenic
1121011318 14:90521817-90521839 GGGGAAACTGAGGCCCAGAGTGG + Intergenic
1121101811 14:91254591-91254613 TAGGGGAATGAGGCACAGAGAGG + Intergenic
1121167644 14:91822627-91822649 TGGGGAGATGAAGCACAGAGAGG + Intronic
1121242207 14:92439139-92439161 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1121310235 14:92931834-92931856 TGGACAAATGAGGCTCAGAGAGG + Intronic
1121437717 14:93929908-93929930 TGGGGCAAGGAGACCCCCAGAGG - Intergenic
1121463791 14:94101550-94101572 AGGGGAACAGAGGCCCAGGGAGG + Intronic
1121509764 14:94503621-94503643 GAGGGAAATGAGGCCCAGAGTGG + Intronic
1121589533 14:95092596-95092618 GAGGAAACGGAGGCCCAGAGAGG + Intronic
1121644905 14:95511155-95511177 TGGGGGAAGCAGGTTCAGAGAGG - Intergenic
1121645662 14:95516028-95516050 TGTGGGAATGAGGCTCAGAGAGG + Intergenic
1121660045 14:95627984-95628006 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1121937087 14:98029854-98029876 TGGGGAGACCAGGCACAGAGAGG + Intergenic
1122031114 14:98913259-98913281 TGGGGAAACCAGGCCGAGAGGGG - Intergenic
1122283096 14:100635881-100635903 TGGGAAACTGAGGACCAGAGAGG + Intergenic
1122414766 14:101543612-101543634 TGGTAAATTGAGGCCCAGAGAGG - Intergenic
1122523300 14:102362312-102362334 TGGGGAATCGAGGCTCAGAGGGG - Intronic
1122717377 14:103703649-103703671 TGGGGAACGGAGGTTCACAGGGG - Intronic
1122743454 14:103884984-103885006 GGGGAAATGGAGGCCCAGAGAGG - Intergenic
1122744702 14:103890891-103890913 TGAGGAAATGAGGCACTGAGAGG - Intergenic
1122778441 14:104133434-104133456 TGAGGAAATGAGGCCCAGAGTGG - Intergenic
1122861072 14:104582617-104582639 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1122861170 14:104582949-104582971 GGGGAAAATGAGGCCCAGGGAGG + Intronic
1122960255 14:105090932-105090954 GGGGAAACGGAAGCCCAGAGAGG - Intergenic
1202928960 14_KI270725v1_random:22664-22686 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
1123697954 15:22892495-22892517 TGAGATAAGGAGGCCCAGGGTGG - Intronic
1124037921 15:26073502-26073524 TGAGGGAAGGAGGCACAGAGAGG + Intergenic
1124645313 15:31434203-31434225 TGGGGAAATGAGGCTCAGAGAGG + Intronic
1124857600 15:33405883-33405905 TGGGGCAAAGAGGCCCACAGTGG + Intronic
1125200849 15:37099755-37099777 GGGGGAAAGGAGGACCGAAGAGG - Exonic
1125582040 15:40792832-40792854 TGGAGAATGGAGGTTCAGAGAGG - Intronic
1125599357 15:40906929-40906951 TGGGGGAAGGGGACCAAGAGGGG + Intergenic
1125715768 15:41819179-41819201 GGGGGAGAGGAGGCTCAGTGGGG - Intronic
1125735747 15:41924381-41924403 TGAGGAAACGAGGCACAGAGAGG - Intronic
1126111321 15:45176515-45176537 TGGGAAAGAGAGGCCAAGAGAGG - Intronic
1126158398 15:45586483-45586505 AGAGGAAAAGAGGCCCAAAGAGG + Intergenic
1126465443 15:48957295-48957317 TGAGAAAATGAGGCCCACAGAGG + Intronic
1127449821 15:59105453-59105475 CGGGGAAAGGCGGGCCGGAGAGG - Intronic
1128093029 15:64931764-64931786 TTGGGAAACAAGGCTCAGAGAGG - Intronic
1128306997 15:66605271-66605293 TTGGGAAAACAGGCCCAGAGAGG - Intronic
1128314503 15:66652183-66652205 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1128334993 15:66780075-66780097 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1128371063 15:67039707-67039729 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1128501001 15:68227729-68227751 GGGGAAATGGAGGCCCAAAGAGG - Intronic
1128566284 15:68702248-68702270 TAAGGAAATGAGGCCCACAGAGG - Intronic
1128672592 15:69585722-69585744 TAGGGACAGGCAGCCCAGAGCGG - Intergenic
1128738017 15:70064474-70064496 TGGGGAAAGAAGGCCAGGACAGG + Intronic
1128842567 15:70862146-70862168 TGGGGAATGGAGGACCAGGGTGG - Intronic
1129034081 15:72639381-72639403 TGGGGAAAGGAGACCTTCAGGGG - Intergenic
1129199145 15:73988492-73988514 TGGTAAACTGAGGCCCAGAGTGG + Intronic
1129199360 15:73989705-73989727 TGAGAAATGAAGGCCCAGAGAGG + Intronic
1129215801 15:74097835-74097857 TGGGGAAAGGAGACCTTCAGGGG + Intergenic
1129236746 15:74228305-74228327 TGAGGAAAGGAGGTGCAGAGAGG - Intergenic
1129274141 15:74434194-74434216 AGTGGAACTGAGGCCCAGAGAGG - Exonic
1129304954 15:74653210-74653232 TGAGGACATGAGGCCCAGAGAGG - Intronic
1129409005 15:75338620-75338642 TGGGGAAAGGAGACCTTCAGGGG - Intronic
1129603868 15:77015353-77015375 TGGGGACAGGAGGCCCAAACAGG - Intronic
1129681019 15:77658313-77658335 TGGGAAACTGAGGCCCAGAGAGG + Intronic
1129847713 15:78775573-78775595 GGGGAAACAGAGGCCCAGAGAGG + Intronic
1129884884 15:79031042-79031064 TGGCCATAGGAGGCCCAGAGGGG - Intronic
1130459848 15:84152757-84152779 TGGGGAAAGGAGGGTCCCAGGGG + Intergenic
1130534066 15:84770612-84770634 TGGAGAACTGAGGCTCAGAGAGG - Intronic
1130980288 15:88807608-88807630 AGGCGAGAGGAGGACCAGAGAGG + Intronic
1131159270 15:90093939-90093961 TGGGAAACTGAGGCTCAGAGAGG + Intronic
1131388749 15:92030035-92030057 TGGTGATAGGAGTCCCAAAGGGG + Intronic
1131390566 15:92044556-92044578 TGGAGGAAGGAGCTCCAGAGTGG - Intronic
1131506623 15:93025422-93025444 TGGGAAAAGGAGGCCCACTCAGG - Exonic
1132315944 15:100890615-100890637 TGAGAAACTGAGGCCCAGAGAGG + Intronic
1132925118 16:2425274-2425296 AGAGGAGAGCAGGCCCAGAGAGG + Intergenic
1133233163 16:4375902-4375924 TGGGAGACGGAAGCCCAGAGAGG + Intronic
1133493331 16:6293193-6293215 GGGGGAAATGAGAACCAGAGAGG + Intronic
1133756044 16:8763289-8763311 GGGGGAACTGAGGACCAGAGAGG - Intronic
1133760764 16:8796801-8796823 TAGGGAAACTAAGCCCAGAGAGG + Intronic
1133966995 16:10538671-10538693 TGGAGAAGGGAGGCCTAGGGTGG + Intronic
1133969386 16:10556592-10556614 TGGGGAAGGGGTGCCCACAGGGG + Intronic
1134073040 16:11272463-11272485 TAGGCAAAAGAGGCCCAGGGAGG - Intronic
1134095594 16:11416428-11416450 TGAGGAATGGAGGCTCAGAGAGG - Intronic
1134220007 16:12346438-12346460 TGAGAAACTGAGGCCCAGAGAGG + Intronic
1134322165 16:13174033-13174055 TGGGAAACTGAGGCCTAGAGAGG - Intronic
1134389608 16:13807286-13807308 TAGTGACAGGAGGCCCACAGCGG - Intergenic
1134447901 16:14344568-14344590 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1134456234 16:14397589-14397611 TGGTCAAGGGAGGCACAGAGAGG + Intergenic
1134509109 16:14832075-14832097 TGGGAAACTGAGGCCCAGAGAGG - Intronic
1134657863 16:15960716-15960738 GGGGGAAGGGAGTCCCAGAGTGG + Intronic
1134659926 16:15976429-15976451 TGGGGAAAGGAGGCAGAGAGAGG + Intronic
1134675128 16:16085033-16085055 AGGAAAAAGGAGGCACAGAGAGG + Intronic
1134696810 16:16230909-16230931 TGGGAAACTGAGGCCCAGAGAGG - Intergenic
1134828122 16:17300973-17300995 AAAGGAACGGAGGCCCAGAGAGG - Intronic
1134975027 16:18563787-18563809 TGGGAAACTGAGGCCCAGAGAGG + Intergenic
1135044090 16:19140442-19140464 CATTGAAAGGAGGCCCAGAGAGG + Intronic
1135382317 16:22005310-22005332 TGGGGGTAAAAGGCCCAGAGAGG + Intergenic
1135643561 16:24142116-24142138 TGGGGAACTGAGACTCAGAGAGG + Intronic
1135773622 16:25236553-25236575 TGAGGAGCCGAGGCCCAGAGAGG + Exonic
1136016864 16:27406046-27406068 TGGGGAAAGGAGGCCCAGAGAGG - Intronic
1136294082 16:29291881-29291903 ATGGGAACAGAGGCCCAGAGGGG + Intergenic
1136462007 16:30417456-30417478 TGGGGAACTGAGGCTCACAGAGG + Intronic
1136541211 16:30928465-30928487 AGGTGAAAGGAGGCCGAGAGAGG + Exonic
1136541355 16:30929084-30929106 AAGGGAAATAAGGCCCAGAGAGG + Intronic
1136556083 16:31008600-31008622 GGGGAAACTGAGGCCCAGAGTGG - Intronic
1136615114 16:31393744-31393766 TGGGGGAAACAGGCCCAGGGAGG - Intronic
1136995214 16:35184366-35184388 TGGGGTGAGGAGGCCCAGGTGGG + Intergenic
1137057461 16:35752496-35752518 TGGGAAAAGGGGAGCCAGAGAGG - Intergenic
1137374941 16:47944336-47944358 AGGGGAAAGCAGGGCCAGGGAGG + Intergenic
1137564328 16:49523963-49523985 TGAGGAAATGGAGCCCAGAGAGG - Intronic
1137591206 16:49695039-49695061 TGGGGAATGGAAGCCCAGGGAGG - Intronic
1137669988 16:50273229-50273251 TAGGAAACTGAGGCCCAGAGAGG + Intronic
1137752438 16:50876790-50876812 GGGGAAACTGAGGCCCAGAGGGG + Intergenic
1138148919 16:54637344-54637366 TTTAGGAAGGAGGCCCAGAGAGG + Intergenic
1138293650 16:55868846-55868868 TGGAAAATGGAGGCCCAGAGAGG - Intronic
1138342900 16:56302360-56302382 TGGGAAACTGAGGCACAGAGAGG - Intronic
1138432474 16:56977899-56977921 TGAGAAACTGAGGCCCAGAGAGG + Intronic
1138447403 16:57073059-57073081 AGGGGATTGGAGGCCCAGTGAGG + Intronic
1138454544 16:57113830-57113852 TGGGGAAGTGTGGCCCAGAGAGG - Intronic
1138454575 16:57113966-57113988 GGGGAAACTGAGGCCCAGAGGGG - Intronic
1138482821 16:57315275-57315297 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1138501125 16:57445649-57445671 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138519747 16:57564125-57564147 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138529409 16:57627000-57627022 TGGGGCAGGGAGGCACAGTGGGG - Intronic
1138531282 16:57635683-57635705 AGGGAAAGGGAGGCTCAGAGGGG - Intronic
1138560258 16:57797160-57797182 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1138582343 16:57949686-57949708 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1138891682 16:61150518-61150540 TGGGGGACGGGGGCTCAGAGAGG + Intergenic
1139272808 16:65699532-65699554 GGTGGAAAATAGGCCCAGAGAGG + Intergenic
1139334246 16:66220002-66220024 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1139346147 16:66305152-66305174 TGGGGAAAGGATGGCCCCAGTGG + Intergenic
1139420506 16:66846789-66846811 TGCTGATAGGAGGCCCAGAGAGG - Intronic
1139442802 16:66977288-66977310 TGGGGAAAAGAAGCCCCGATAGG + Intergenic
1139505498 16:67396322-67396344 TGGGGAAAGCAGGCCCGGGAAGG + Intronic
1139701921 16:68713069-68713091 TGGGGAGAGGAGGGACAGAAGGG - Intronic
1140920960 16:79537585-79537607 TGGGGTAAAGAGCCACAGAGCGG - Intergenic
1140978550 16:80084297-80084319 GCAGGAAAAGAGGCCCAGAGTGG - Intergenic
1140985988 16:80158378-80158400 AGGGAAAATGAGGCTCAGAGAGG - Intergenic
1141096436 16:81166208-81166230 TGGGGGATGGAGGCACAGAGAGG + Intergenic
1141127294 16:81409624-81409646 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1141154847 16:81590175-81590197 AGGGAAACGGAGGCTCAGAGGGG - Intronic
1141169887 16:81684646-81684668 TGAGAAACGGAGGTCCAGAGAGG - Intronic
1141267782 16:82512569-82512591 GGGGAAATGGAGGCCCAGAGGGG - Intergenic
1141491834 16:84379114-84379136 AGGGGAAAGGAGGGGAAGAGAGG - Intronic
1141491841 16:84379134-84379156 AGGGGAAAGGAGGGGAAGAGAGG - Intronic
1141526467 16:84614957-84614979 GAGGAAACGGAGGCCCAGAGAGG - Intronic
1141663434 16:85453738-85453760 AGGGAAAAGGAGGTCTAGAGAGG - Intergenic
1141769544 16:86081138-86081160 TGGGGAACTGAGGTTCAGAGAGG + Intergenic
1141797470 16:86285072-86285094 GGGGGAACTGAGGCCCAAAGAGG - Intergenic
1141800831 16:86308096-86308118 GGGGAAACAGAGGCCCAGAGAGG + Intergenic
1141867090 16:86757824-86757846 ATGGGAACTGAGGCCCAGAGAGG - Intergenic
1141868318 16:86766394-86766416 TAGAGAAAGGTGACCCAGAGTGG + Intergenic
1141875643 16:86822493-86822515 TGGGCAGAGGAGGCTCAGAAGGG + Intergenic
1142171546 16:88625133-88625155 TGGGGAGGGGAGGCCGCGAGGGG + Intronic
1142225568 16:88875618-88875640 TGGGGTGAGGGGGCCGAGAGAGG + Exonic
1142232578 16:88906736-88906758 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1142245429 16:88968138-88968160 TGGAGGAAATAGGCCCAGAGAGG + Intronic
1142266213 16:89065072-89065094 TGTGGAGAGGAGGCTCAGAAGGG + Intergenic
1142308343 16:89298243-89298265 TGTGGAAAGGAGGCCCAGGGTGG - Intronic
1142473410 17:176071-176093 TAGAGAAATGAGGCTCAGAGAGG + Intronic
1142496033 17:306805-306827 GGAGGAAAAGAGGCCCTGAGGGG - Intronic
1142610672 17:1107970-1107992 AGGGGCAGGGAGGCCCAGAGAGG + Intronic
1142610701 17:1108109-1108131 TCGAGAAGGGAGGCCCAGTGAGG - Intronic
1142715884 17:1746796-1746818 TGGGAAACGGAAGCCCAGAGAGG + Intronic
1142882949 17:2895434-2895456 AGGGAAAATGAGGCTCAGAGAGG - Intronic
1142931972 17:3292808-3292830 TGGAGGAGGGAGGTCCAGAGTGG - Intergenic
1142975629 17:3642267-3642289 GAGGGGAAGCAGGCCCAGAGAGG + Intronic
1143020453 17:3914809-3914831 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1143029920 17:3962212-3962234 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1143071192 17:4294967-4294989 GGGGAAAAGGAGGGGCAGAGTGG + Intronic
1143485410 17:7251381-7251403 GGGGGAACGGGGGCCCCGAGTGG + Exonic
1143609002 17:8006944-8006966 AGGGGGATGGGGGCCCAGAGAGG - Intronic
1143654581 17:8286415-8286437 TGAGGAAATGAGACTCAGAGAGG + Intergenic
1143721898 17:8818293-8818315 TGGGGAAGTGAAGTCCAGAGAGG + Intronic
1143864438 17:9913656-9913678 GGTAGAAAGGAGGCCCAGGGTGG + Intronic
1143867054 17:9931559-9931581 AGGGGAAGGGAGGCCTTGAGGGG + Intronic
1143952516 17:10644979-10645001 TGGGCATCGGAGGCCCAGAAAGG + Intronic
1144050076 17:11490786-11490808 TGGGGCTAAGAGGCCCAGGGAGG + Intronic
1144053594 17:11518728-11518750 TGGGGAAAGGAGGCACCCATTGG + Intronic
1144575506 17:16427157-16427179 GAGGGAAGGGAGGCACAGAGAGG + Intronic
1144659356 17:17058327-17058349 TGGGGAATGGGGACCCAGGGAGG + Intronic
1144762064 17:17712641-17712663 TGGGCCTAGGAGGCCCAGAAGGG + Intronic
1144774397 17:17777748-17777770 GGGGAAACTGAGGCCCAGAGGGG + Intronic
1144782501 17:17815074-17815096 TGGGGAGAGGAAACTCAGAGAGG + Intronic
1144866142 17:18337201-18337223 TGAGGAAATGAGGAACAGAGAGG + Intronic
1144951053 17:18993659-18993681 TGGGAAAGTGAGGCCCAGAGAGG - Intronic
1145004539 17:19329974-19329996 TGGGAAAAGGAGGCCCTCTGAGG - Intronic
1145018159 17:19412154-19412176 TAGGAAATTGAGGCCCAGAGAGG + Intronic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1145098371 17:20051946-20051968 TGGGGAAATGGGGGTCAGAGAGG - Intronic
1145267844 17:21389035-21389057 TAGGGAAATGAGGTTCAGAGAGG - Intronic
1145270378 17:21401593-21401615 GGGGAAACTGAGGCCCAGAGGGG + Intronic
1145270644 17:21402946-21402968 GGAGGAAATGAGGCACAGAGAGG - Intronic
1145389242 17:22443119-22443141 TTGGGAAAAGAGGGCCAGTGGGG - Intergenic
1146061791 17:29611728-29611750 TGTGGAAAGGAGGTCCACATAGG - Intronic
1146121203 17:30196899-30196921 TGGGGAAAGGAGGCCAAGGGAGG + Exonic
1146318153 17:31825474-31825496 TGGGAAACTGAGGCCCAGACAGG + Intergenic
1146481260 17:33206681-33206703 TGGGGAAGGGAGGCTCTGAGGGG + Intronic
1146490075 17:33274784-33274806 TGGGCACTAGAGGCCCAGAGCGG + Intronic
1146502815 17:33378940-33378962 TGGGAAAATAAGACCCAGAGAGG - Intronic
1146568950 17:33936736-33936758 GGAGGAAACGAGGCCCAGGGAGG - Intronic
1146639332 17:34528008-34528030 CGGGGAAGGGAGGCCCTAAGCGG - Intergenic
1146918286 17:36692012-36692034 TGGAGAAAGGAGACACTGAGGGG - Intergenic
1146925788 17:36743880-36743902 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1147057534 17:37845806-37845828 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1147538806 17:41339433-41339455 TGAGGAAATGAGGCATAGAGGGG - Intergenic
1147556862 17:41485320-41485342 TTGAGAAAACAGGCCCAGAGAGG - Intergenic
1147582775 17:41636457-41636479 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1147603960 17:41763503-41763525 TGAGGCAATGAGGCTCAGAGAGG + Intronic
1147656791 17:42095655-42095677 TGAGGTCAGGAGGCCCACAGGGG + Intergenic
1147665613 17:42145451-42145473 TTTGGGAAGGAGGACCAGAGAGG - Intronic
1147669730 17:42170031-42170053 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1147790422 17:43011097-43011119 TGAAGAAATGAAGCCCAGAGTGG - Intronic
1147805991 17:43132139-43132161 TGAGGAACTGAGGCACAGAGAGG + Intergenic
1147869384 17:43576939-43576961 TTGGGAATGGAGGCCCACAGAGG + Intronic
1148167704 17:45494879-45494901 TGAGGAACTGAGGCTCAGAGAGG - Intergenic
1148458016 17:47821306-47821328 TGAGGAACTGAGGCCCAGAGGGG + Intronic
1148546452 17:48522761-48522783 CTGGGAAAATAGGCCCAGAGAGG + Intergenic
1148677959 17:49455883-49455905 GGGAGAACAGAGGCCCAGAGTGG - Intronic
1148735516 17:49862714-49862736 TGGGGCCAGGAGGGCCAGGGTGG + Intergenic
1148737141 17:49871227-49871249 TGAGGCATGGTGGCCCAGAGAGG - Intergenic
1148763872 17:50026322-50026344 GGGGGAACTGAGGCCTAGAGGGG + Intergenic
1148821358 17:50361612-50361634 AGGGGTAAACAGGCCCAGAGAGG + Intronic
1148858429 17:50591665-50591687 TGGGGGCAGGAGGGCCTGAGGGG + Intronic
1148895045 17:50834643-50834665 GGAGGAAAGGACGCACAGAGAGG - Intronic
1149260913 17:54878538-54878560 TGAGAAAAGGGGGCCCAGAGTGG + Intergenic
1149443623 17:56696730-56696752 TGAGGAAATGAGACCCAAAGAGG + Intergenic
1149515349 17:57276951-57276973 AGGGGAAAGGAGACCTGGAGAGG + Intronic
1149685871 17:58534373-58534395 GGGGAAACAGAGGCCCAGAGAGG - Intronic
1149854890 17:60073612-60073634 TGAGGAAACAAGGCCCAGAGTGG + Intronic
1150267161 17:63838974-63838996 TGGGGAGAGGAGGAGCAGGGTGG + Intronic
1150398883 17:64841294-64841316 TGAGGAACTGAGGCTCAGAGAGG - Intergenic
1150696735 17:67411875-67411897 TGGGAAACTGAGGCACAGAGAGG + Intronic
1151168299 17:72223740-72223762 TGGGAAACTGAGGCACAGAGAGG - Intergenic
1151682779 17:75630517-75630539 TGGGGAGAGGTGGCCCAAACAGG + Intronic
1151714407 17:75823983-75824005 GGGGAAAATGAGGCCCAGAAAGG - Intronic
1151727061 17:75891352-75891374 TGGGGAAAGGAGGACAGCAGTGG + Intronic
1151819452 17:76489809-76489831 TGGTGAATGGAGGCTCAGAGGGG + Intronic
1151888810 17:76940171-76940193 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1152014431 17:77741017-77741039 TGAAGAAAAGAGGCCCAGAGAGG - Intergenic
1152136392 17:78506462-78506484 GGGGAAAATGAGGCACAGAGAGG + Intronic
1152282220 17:79391606-79391628 TGAAGAAATGAGGCCCAGTGAGG + Intronic
1152457754 17:80425875-80425897 TGGGTGCAGGAGGCTCAGAGAGG - Intronic
1152467068 17:80472527-80472549 TGGGGAAAGGGGGCCCAGAATGG + Intronic
1152581661 17:81168044-81168066 TGGGGAGGGGAGGCCCTGACAGG - Intergenic
1152715929 17:81900683-81900705 TAGGGAAAGGTGGCCCTGGGAGG + Intronic
1152730223 17:81966507-81966529 GGGGAAACGAAGGCCCAGAGGGG + Intergenic
1152764622 17:82129297-82129319 TGTGGAAAGGAAGCCAAAAGGGG + Intronic
1152863917 17:82711001-82711023 GGGGAAACTGAGGCCCAGAGGGG - Intergenic
1153329878 18:3862883-3862905 CGGGGCAGGGAGGCCCAGTGAGG - Intronic
1153753374 18:8256340-8256362 TTGGAAACTGAGGCCCAGAGAGG - Intronic
1154021563 18:10668161-10668183 TGGGAAGAGAGGGCCCAGAGTGG + Intronic
1154494680 18:14946798-14946820 GAGGGAAATGTGGCCCAGAGGGG - Intergenic
1155599048 18:27522981-27523003 TAGGAAAATGAGGCCCAGAGAGG - Intergenic
1156363130 18:36401619-36401641 TGGGAAAGTGAGGCTCAGAGAGG - Intronic
1156436677 18:37138250-37138272 TGAGGAAATGAGGCCCAGAGAGG + Intronic
1156449729 18:37260096-37260118 TGAGGAAGTGAGGCCCAGAGAGG + Intronic
1156554188 18:38048647-38048669 TGGGGAACCAAGGCCCAGAGAGG + Intergenic
1156836286 18:41559161-41559183 TCGGGATAGGATGCACAGAGAGG - Intergenic
1157198841 18:45642021-45642043 TGAGGAAATGAGGCTCAGAGGGG + Intronic
1157334702 18:46729364-46729386 TGGGGAAAGGGGGCCAGGGGTGG + Intronic
1157516779 18:48316866-48316888 TCGGAAACTGAGGCCCAGAGAGG - Intronic
1157566370 18:48681426-48681448 TGGGGAAAGGAGGGAAAGAGTGG - Intronic
1157580166 18:48769456-48769478 TGGGGACAGATGGCCCACAGGGG - Intronic
1157675304 18:49564122-49564144 AGGGGAAAGGAGGGAGAGAGGGG - Intronic
1157779704 18:50427560-50427582 CTGGGAAGTGAGGCCCAGAGAGG - Intergenic
1157917915 18:51687133-51687155 AGGGGAAAATAAGCCCAGAGAGG - Intergenic
1157953342 18:52064873-52064895 TGGCCAGTGGAGGCCCAGAGGGG + Intergenic
1158197809 18:54908569-54908591 TGAGGAAATTAGGCACAGAGAGG - Intronic
1159031526 18:63237171-63237193 TGTGGTATGGAGGCCGAGAGAGG + Intronic
1159161315 18:64646544-64646566 AGGGGAGAGGAGACCCATAGTGG + Intergenic
1160062747 18:75547794-75547816 TGAGGAAAGGATACCCAGAGAGG - Intergenic
1160241810 18:77130370-77130392 TGAGGAAACAAGGCCCAGAGAGG - Intronic
1160445796 18:78925967-78925989 TGGTGAATGCAGGCCCAGCGCGG + Intergenic
1160526899 18:79543641-79543663 GAGGGACAGGAGGCCCTGAGAGG + Intergenic
1160582140 18:79888967-79888989 TGGGCAAAGGAGGGCCAGCGTGG - Intronic
1160657744 19:281989-282011 TGGGGGAAGGGGTCCCAGGGAGG + Intronic
1160748631 19:723211-723233 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1160798576 19:956791-956813 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1160833527 19:1114017-1114039 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1160896123 19:1402665-1402687 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1160990709 19:1859241-1859263 GGGGAAACTGAGGCCCAGAGGGG - Intronic
1161006042 19:1937301-1937323 AGGGGAATGGAGGCCCAGGGTGG + Intergenic
1161100810 19:2420679-2420701 TGGGGATCAGAGTCCCAGAGAGG - Intronic
1161209528 19:3058941-3058963 GGAGGAAATGAAGCCCAGAGAGG - Intronic
1161242276 19:3228980-3229002 GGGGAAAACGAGGCACAGAGAGG - Intronic
1161272801 19:3399199-3399221 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1161346864 19:3772449-3772471 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1161399543 19:4061273-4061295 AGGGGAGATCAGGCCCAGAGAGG + Intronic
1161417802 19:4157357-4157379 GAGGAAATGGAGGCCCAGAGAGG + Intronic
1161423612 19:4189811-4189833 TGAGGGAGGGAAGCCCAGAGAGG + Intronic
1161495549 19:4584138-4584160 TGGGCCAGGGAGGCCCAGGGAGG + Intergenic
1161576446 19:5057137-5057159 TGGGAAAAGGAGGCACAGGTGGG - Intronic
1161663643 19:5561999-5562021 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1161771041 19:6230802-6230824 AGGGGAACAGAGGCCCAGTGAGG - Intronic
1161820995 19:6531355-6531377 GGGAGAAGGGAGTCCCAGAGGGG - Intronic
1161843975 19:6701042-6701064 TGGGAAAAGAAGTCCCAGACAGG + Intronic
1162146633 19:8616415-8616437 TGAGGAAACTAAGCCCAGAGAGG + Intergenic
1162411739 19:10510337-10510359 TGGGGACAGGTGTCCCAGACTGG - Intergenic
1162489083 19:10981203-10981225 TGGGGACAGAAGGCCCAGAGGGG + Intronic
1162531526 19:11238810-11238832 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1162550357 19:11355197-11355219 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1162809826 19:13157077-13157099 TTGGGGAAACAGGCCCAGAGAGG - Intergenic
1162811417 19:13166365-13166387 AGGGGAACTGAGGCACAGAGTGG + Intergenic
1162825059 19:13246185-13246207 CAGGAAATGGAGGCCCAGAGAGG - Intronic
1162832377 19:13293816-13293838 GAGGAAATGGAGGCCCAGAGAGG + Intronic
1162908484 19:13836984-13837006 TGGGGAGAGGAAGCCAAGGGGGG + Intergenic
1162913589 19:13862883-13862905 TGGGCAACCGAGGCCCAGATGGG - Intronic
1162945612 19:14041581-14041603 GAGGGAACTGAGGCCCAGAGAGG - Intronic
1163027338 19:14519884-14519906 TGGGAAAAGGAGGCTCAGAAAGG + Intronic
1163156281 19:15441330-15441352 TGGAAAACTGAGGCCCAGAGTGG - Intronic
1163189096 19:15663159-15663181 TGTGAAAATGAGGCCAAGAGGGG - Intergenic
1163532028 19:17855621-17855643 GGGGAAACTGAGGCCCAGAGCGG + Intergenic
1163557120 19:17999164-17999186 GGGGAAACTGAGGCCCAGAGAGG + Exonic
1163659366 19:18567608-18567630 AGGGAAACAGAGGCCCAGAGGGG + Intronic
1163664220 19:18595421-18595443 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1163687033 19:18717556-18717578 TGGGGCACTGGGGCCCAGAGAGG + Intronic
1163725437 19:18920770-18920792 TGGGAAAAGGGCGCTCAGAGAGG - Intronic
1163885754 19:19963353-19963375 TGGTGAAAGGAAGCCCAGGTTGG - Intergenic
1163888745 19:19992316-19992338 TGGTGAAAGGAAGCCCAGGTTGG + Intergenic
1164811577 19:31161625-31161647 AGGGGAAGGGTGACCCAGAGGGG - Intergenic
1165060507 19:33202822-33202844 TCGGGAGAGGAGGCCGAGAAAGG - Intronic
1165281580 19:34802786-34802808 TGGGGACATGCGGCTCAGAGGGG - Intergenic
1165299842 19:34961738-34961760 TGGGGGTAGGATGGCCAGAGGGG - Intronic
1165357037 19:35310699-35310721 TGGGAGATGGAGGCCCAGAGTGG + Intronic
1165411900 19:35667079-35667101 TGAGGAAAGAAGGCACAGAGAGG - Intronic
1165429656 19:35765257-35765279 TGGAGAAACAAGGCCCAGAGAGG - Intronic
1165513668 19:36279021-36279043 TGGGGAGAGGACTGCCAGAGGGG - Intergenic
1165515323 19:36286625-36286647 TGGGGAGAGGACTGCCAGAGGGG - Intergenic
1165516424 19:36291698-36291720 TGGGGAGAGGACTGCCAGAGGGG - Intergenic
1165519180 19:36304349-36304371 TGGGGAGAGGACTGCCAGAGGGG - Intergenic
1165739384 19:38196355-38196377 TGGAGCAAGGAGGCCAAGGGCGG + Intronic
1165749753 19:38252683-38252705 GAGGAAAATGAGGCCCAGAGAGG - Intronic
1165777574 19:38413617-38413639 TGGGAAACTGAGGCCCAGAGAGG - Intronic
1165853887 19:38868816-38868838 AGGGGAAGGGAGGAGCAGAGTGG - Intronic
1165894052 19:39131079-39131101 ATGAGAAAGGAGGCCCAGAGAGG + Intronic
1165895685 19:39139579-39139601 TGGGGGAAGGTGAGCCAGAGAGG + Intronic
1165988927 19:39794804-39794826 AGGGGAAAGGGTGCCAAGAGAGG + Intergenic
1166200361 19:41233680-41233702 TGAGGAACTGAGGCCCAGAGAGG + Intronic
1166200371 19:41233708-41233730 GGAGGAACTGAGGCCCAGAGAGG - Intronic
1166340714 19:42135040-42135062 TGGGGAACTGAGCCACAGAGAGG - Intronic
1166343457 19:42151624-42151646 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1166354633 19:42219637-42219659 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1166517552 19:43458713-43458735 TGGGGAAATCAGGGCTAGAGAGG - Intergenic
1166565600 19:43763638-43763660 GGGGGAAAGGCGGTCCAGAGAGG - Intergenic
1166811056 19:45514941-45514963 TGAGGACTAGAGGCCCAGAGAGG - Intronic
1167041404 19:47024692-47024714 TGGAGGACTGAGGCCCAGAGAGG - Intronic
1167103297 19:47417046-47417068 AGGGGACAAGAGACCCAGAGAGG + Intronic
1167247984 19:48385319-48385341 TGGGGGAAGGATGGCCAGGGAGG - Intronic
1167278007 19:48550474-48550496 TGCAGGAAGGGGGCCCAGAGAGG - Intergenic
1167285209 19:48595375-48595397 TGGTAAACAGAGGCCCAGAGAGG - Intronic
1167285570 19:48596990-48597012 TGAGAAACTGAGGCCCAGAGAGG - Intronic
1167443826 19:49525759-49525781 GGGGGAACAGAGACCCAGAGGGG + Intronic
1167459195 19:49615465-49615487 AGGGGAATAGAGACCCAGAGAGG + Intronic
1167477914 19:49711654-49711676 TGGGGAACTGAGGCTTAGAGAGG - Intronic
1167621267 19:50562312-50562334 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1168271649 19:55253241-55253263 TGTGGAAGAGGGGCCCAGAGGGG + Intronic
1168280689 19:55303938-55303960 TGAGGAAATGAGGCCCAGAGAGG - Intronic
1168284697 19:55325104-55325126 TTGGGTATGGAGGCTCAGAGCGG - Intronic
1168376337 19:55883075-55883097 TGAGGAAAGGAGAGCCAGAGGGG - Intergenic
1168411449 19:56142717-56142739 TGGAGAAATGAAGCACAGAGGGG + Intronic
1168435778 19:56315663-56315685 AGGGAAACTGAGGCCCAGAGAGG - Intronic
925528238 2:4828866-4828888 TAGGAAAAGGAGGCCCAGACAGG - Intergenic
925587228 2:5475832-5475854 TGGGGAAAGGATGGCAAGAGGGG - Intergenic
925665567 2:6251768-6251790 TGGGGACAGGAGGCACCAAGAGG + Intergenic
925718144 2:6803675-6803697 TGGGGAAGGGAGGTCCACTGAGG - Intergenic
925810492 2:7695296-7695318 CTGGGAAAGGTAGCCCAGAGGGG + Intergenic
926055476 2:9771555-9771577 TGGGGGAGCCAGGCCCAGAGAGG - Intergenic
926092167 2:10058171-10058193 AGGGAAACTGAGGCCCAGAGAGG + Exonic
926111921 2:10189077-10189099 TGGGGAATGGAGGCACAGGAGGG + Intronic
926215999 2:10905696-10905718 TGGGGAAAGGAGGGCTGGAGAGG + Intergenic
926272720 2:11378745-11378767 TGAGAAAACGAGGCTCAGAGAGG - Intergenic
926689535 2:15723976-15723998 AGGGGAAATGAAGCCCAGAGCGG + Intronic
926794939 2:16611559-16611581 TGGGGAAAGGAGTCTAAAAGAGG + Intronic
926989633 2:18663813-18663835 AGGGGAAGGGTGGCACAGAGAGG + Intergenic
927198313 2:20563289-20563311 GGGGAAACTGAGGCCCAGAGAGG + Intronic
927666593 2:25037069-25037091 TGGGAAATTGAGGCCCAGAGAGG - Intergenic
927791312 2:26011917-26011939 TGGGGAAAGGAACCCTGGAGAGG + Intergenic
927855062 2:26522782-26522804 AGGGAAACTGAGGCCCAGAGAGG - Intronic
927881318 2:26692101-26692123 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
927886776 2:26723670-26723692 GAGGAAATGGAGGCCCAGAGAGG - Intronic
928097607 2:28413990-28414012 TGGGGAGAAAAGGCTCAGAGGGG - Exonic
928118634 2:28565905-28565927 TGAGGAAACAAGGCTCAGAGAGG + Intronic
928169092 2:28991911-28991933 TGGGAAACGGAGGCTGAGAGGGG + Intronic
928657060 2:33463511-33463533 TGAAGAAAGGGGGCCCACAGAGG + Intronic
929396169 2:41525176-41525198 TGGGGAAAGGAGCTCCCGTGTGG + Intergenic
929570848 2:43022049-43022071 TGGCCAAGGGAGGCCCAGAGGGG - Intergenic
929916711 2:46142633-46142655 AGGGGAAAGGTGGTCCAGGGTGG - Intronic
930013926 2:46957959-46957981 GGGGAAACTGAGGCCCAGAGAGG + Intronic
930014469 2:46960877-46960899 GGGCTGAAGGAGGCCCAGAGAGG - Intronic
930381574 2:50636362-50636384 AGGGAAAATGAGGCCCAGTGAGG - Intronic
930495343 2:52134597-52134619 TGGGGAAAAGAGCCCCAGCCCGG + Intergenic
930570908 2:53085865-53085887 TGGAAAAAGGAGGACCAGATTGG + Intergenic
930724005 2:54665118-54665140 TGGGGAACAGAGGCTCTGAGCGG + Intronic
931176296 2:59858415-59858437 TTGGAAATGGAGGCTCAGAGAGG + Intergenic
931177902 2:59871642-59871664 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
932282174 2:70502950-70502972 TGGGGGACGGAGGCACAGAGTGG + Intronic
932416062 2:71574529-71574551 TGGGGAAAGCAGCCCCAGTCTGG + Intronic
932498565 2:72160083-72160105 AAGGGAAGTGAGGCCCAGAGAGG + Intergenic
932576021 2:72962922-72962944 TGGGGATTGGAGGATCAGAGGGG - Intronic
932599737 2:73115208-73115230 TGGAGAAATAAGGCCAAGAGAGG - Intronic
933325829 2:80835799-80835821 ATGGGAAAGAAGGCCCAGAGAGG - Intergenic
933525901 2:83438394-83438416 TGGGTAAAGGACACCCAGTGTGG - Intergenic
933724036 2:85416327-85416349 TGGGAAACTGAGGCCCAGAGAGG - Intronic
933739745 2:85524102-85524124 TTGGGAAACAAGGCCAAGAGGGG - Intergenic
933769390 2:85733630-85733652 TTGGGAGTGGAGGCCCAGCGGGG - Intergenic
933833805 2:86230391-86230413 TGGAGGAAGCAGGCTCAGAGAGG - Intronic
933882343 2:86682103-86682125 AGGGGAAATGAGGACCAAAGTGG - Intronic
933953138 2:87348247-87348269 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
933973356 2:87488203-87488225 AGGAAAAATGAGGCCCAGAGAGG + Intergenic
934179003 2:89603203-89603225 TTGGGAAAGCATGCCCAGTGTGG - Intergenic
934179056 2:89603575-89603597 TTGGAAAAGGAGGCTGAGAGAGG - Intergenic
934237369 2:90244592-90244614 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
934289288 2:91677475-91677497 TTGGGAAAGCATGCCCAGTGTGG - Intergenic
934289342 2:91677845-91677867 TTGGAAAAGGAGGCTGAGAGAGG - Intergenic
934459798 2:94207898-94207920 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
934552643 2:95271720-95271742 TGGGGATGGGAGGCCAAGGGGGG - Intergenic
934553373 2:95275391-95275413 TGGGGAGAGGAGGGACACAGGGG + Intronic
935116090 2:100137727-100137749 TGGAGAACGGAGGCTCAAAGAGG - Intronic
935289403 2:101597002-101597024 GAGGGAACTGAGGCCCAGAGAGG - Intergenic
935289529 2:101598346-101598368 GAGGGAACTGAGGCCCAGAGAGG + Intergenic
936029629 2:109060726-109060748 TGGGAAACTGAGGCCCAGGGTGG - Intergenic
936320365 2:111462007-111462029 AGGAAAAATGAGGCCCAGAGAGG - Intergenic
937094125 2:119224512-119224534 TGGGGACAGGCTGCCCGGAGAGG + Intronic
937224444 2:120360186-120360208 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
937509801 2:122582945-122582967 AGGGGAAAGGAGGACCAGGGAGG + Intergenic
937566191 2:123292148-123292170 CAGTGCAAGGAGGCCCAGAGAGG + Intergenic
938092989 2:128445365-128445387 GGGGAAATTGAGGCCCAGAGCGG + Intergenic
938208127 2:129441000-129441022 TGGGAGAAAGAGGCCCTGAGAGG - Intergenic
938342111 2:130542470-130542492 CGGGGAACTGAGGCCCAGAGAGG - Exonic
938347721 2:130578241-130578263 CGGGGAACTGAGGCCCAGAGAGG + Intronic
939613337 2:144335325-144335347 TGGGGAAAGGAGGACAAGACAGG + Intergenic
940105172 2:150091418-150091440 TGGGGATGGGAGGCAGAGAGGGG + Intergenic
940779714 2:157919573-157919595 TGGAGAACAGAGGCTCAGAGAGG - Intronic
941456959 2:165720644-165720666 TGGAGAAAGGACTGCCAGAGAGG + Intergenic
941998904 2:171627053-171627075 AGGAGACAGGAGACCCAGAGTGG - Intergenic
942073829 2:172338910-172338932 TGAAGAAATGAGGCCCAGGGAGG + Intergenic
942428586 2:175884819-175884841 CGGGGAAAGGAGACCCAGCTGGG + Intergenic
942931731 2:181502009-181502031 TGGCAAAAAGAGGCCCACAGAGG + Intronic
943566371 2:189521722-189521744 TGGGGAAATGAAGCACAGAGTGG + Intergenic
943723085 2:191225621-191225643 TGGGATACTGAGGCCCAGAGAGG + Intergenic
944688476 2:202138603-202138625 TAGGCAAATGAGGCCCAGAGAGG - Intronic
944766768 2:202871909-202871931 TCGGGAAAGGAGGAATAGAGAGG - Intronic
945520927 2:210826155-210826177 TGGGGAAAAGAGCCTAAGAGTGG - Intergenic
945792899 2:214327375-214327397 TGGGAAACTGAGGCACAGAGAGG - Intronic
946013746 2:216587637-216587659 TAGGAAACTGAGGCCCAGAGGGG + Intergenic
946095508 2:217270823-217270845 TGTGGAAAGGAGGCCAGGAAAGG + Intergenic
946131299 2:217609067-217609089 CGGGAAAATGAGGCCCAGAGAGG + Intronic
946153145 2:217789658-217789680 TGGGAAACGGAGGGACAGAGAGG + Intergenic
946253084 2:218425402-218425424 GAGGCAAGGGAGGCCCAGAGAGG + Intronic
946375670 2:219307707-219307729 AGGGGAGAGAAGGCCCAGAAAGG - Intronic
947525664 2:230875309-230875331 GGGGAAACTGAGGCCCAGAGAGG + Intronic
947769444 2:232659426-232659448 TGGGCACAGGAGGACCATAGAGG + Intronic
947825147 2:233100748-233100770 TGGGGAAAGGAGGCTCTAACAGG - Intronic
947998503 2:234548226-234548248 TGGCCAAGGGAGGCACAGAGCGG + Intergenic
948054359 2:235000265-235000287 AGGAGAAGTGAGGCCCAGAGAGG - Intronic
948212996 2:236208701-236208723 AGGGGCAGGGAGCCCCAGAGAGG - Intronic
948217143 2:236240198-236240220 GAGGGAGAGGAGGCCCAGAAGGG + Intronic
948347568 2:237311807-237311829 TGGGCAACAGAGGCTCAGAGAGG - Intergenic
948561763 2:238858640-238858662 GGGGAAACTGAGGCCCAGAGAGG - Intronic
948874034 2:240818045-240818067 GGGGGAAAGGAGGCACCCAGGGG + Intronic
948908257 2:240990068-240990090 AGGGCAATGGAGGCTCAGAGAGG - Intronic
948940810 2:241195466-241195488 TGGGGAACGGAGGCCTGGAGAGG - Intronic
1168794456 20:602406-602428 TGAGCCAGGGAGGCCCAGAGGGG + Intergenic
1168800613 20:641970-641992 TGGGGGGGGGAGGCCCAGCGGGG + Intergenic
1168800708 20:642163-642185 TGGGGGGGGGAGGCCCAGCGGGG + Intergenic
1168909451 20:1435493-1435515 GAAGAAAAGGAGGCCCAGAGGGG + Intergenic
1168955296 20:1830274-1830296 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1169172809 20:3479103-3479125 TGGGGACAGGAGTTCCAGATTGG - Intronic
1169264082 20:4157171-4157193 GAGGGAACGGAGGCACAGAGAGG - Intronic
1169264311 20:4158325-4158347 GGGGCAAAGGAGGACAAGAGAGG - Intronic
1169274077 20:4221464-4221486 GGGGGTAAGGGGGACCAGAGAGG - Exonic
1169318420 20:4611687-4611709 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1170000018 20:11605384-11605406 TGGGGTCAGGAGGCCAAGAAAGG - Intergenic
1170014044 20:11760786-11760808 TTGGGAAATGGGGCCTAGAGAGG - Intergenic
1170229728 20:14031922-14031944 TTGGGAATTGAGGCCTAGAGAGG + Intronic
1170404668 20:16023601-16023623 TGGGGAAATGAGACCGAGAATGG + Intronic
1170654874 20:18277066-18277088 TGGGAAACTGAGGCCCAAAGGGG + Intergenic
1172029381 20:31970919-31970941 GAGGGAATGGAGGCTCAGAGAGG + Intronic
1172033987 20:31999215-31999237 TGGGAAACTGAGGCCCAGAGTGG + Exonic
1172117479 20:32581491-32581513 GGAGGAAGGGAGGCCCAGGGTGG + Intronic
1172176526 20:32975843-32975865 TGGCAAACAGAGGCCCAGAGAGG - Intergenic
1172177134 20:32979378-32979400 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1172184542 20:33023194-33023216 TGGTAAACTGAGGCCCAGAGAGG + Intronic
1172201048 20:33126198-33126220 GAGGGAATTGAGGCCCAGAGAGG + Intergenic
1172277039 20:33685597-33685619 GGAGGAACTGAGGCCCAGAGAGG - Intronic
1172613602 20:36268806-36268828 TTGGGAACTGAGGCCCAGAGAGG + Intronic
1172625464 20:36344107-36344129 GGGGGAAGTGAGGACCAGAGAGG - Intronic
1172633420 20:36393784-36393806 TGAGGAACTGAGGCTCAGAGAGG + Intronic
1172647289 20:36478817-36478839 AGGAAAAAGGAGGCTCAGAGAGG - Intronic
1172672200 20:36642266-36642288 GAGGAAAAGGAGGCACAGAGAGG - Intronic
1172750140 20:37245059-37245081 TGGGAAACCAAGGCCCAGAGAGG - Intergenic
1172811202 20:37649588-37649610 TGAAGAAAGAAGGCTCAGAGAGG + Intergenic
1172818874 20:37713966-37713988 TGAGGAAAGGAAGCTCACAGAGG + Intronic
1172842739 20:37911764-37911786 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1172944438 20:38676360-38676382 GAGGAAAATGAGGCCCAGAGAGG + Intergenic
1173308371 20:41873199-41873221 AGAGGGAGGGAGGCCCAGAGTGG + Intergenic
1173384890 20:42578125-42578147 ATGGGAAAACAGGCCCAGAGTGG + Intronic
1173406992 20:42774907-42774929 TGGAAAAAGGAGGGTCAGAGAGG - Intronic
1173550538 20:43930266-43930288 AGGGTAAGTGAGGCCCAGAGAGG - Intronic
1173564058 20:44026809-44026831 AGAAGGAAGGAGGCCCAGAGAGG - Intronic
1173577789 20:44124195-44124217 TGGGGAAAGGAGGCCAGGGTGGG - Intronic
1173595068 20:44253729-44253751 TGGAGGAAGGGGACCCAGAGAGG - Intronic
1173758497 20:45539266-45539288 TGGGGAAAGGAAACTCAGTGGGG - Intronic
1173836600 20:46130099-46130121 GGTGGAAATGAGGTCCAGAGAGG + Intergenic
1173848246 20:46201394-46201416 GGGGGAGTTGAGGCCCAGAGAGG - Intronic
1174022350 20:47541319-47541341 TGGGGAAAGGAGGGGGAGGGGGG - Intronic
1174180393 20:48670651-48670673 TGAGGAAAGGATACTCAGAGAGG - Intronic
1174185047 20:48700657-48700679 CAGGAAAGGGAGGCCCAGAGAGG + Intronic
1174195035 20:48766981-48767003 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1174280132 20:49433316-49433338 TTGAGAAAAGAGGCACAGAGAGG + Intronic
1174304825 20:49607769-49607791 TGGGAAGCTGAGGCCCAGAGAGG + Intergenic
1174360653 20:50027198-50027220 TGGGAAACTGAGGCCCAGAGAGG + Intergenic
1174402657 20:50284227-50284249 AGAGGAAAAGAGGCTCAGAGAGG - Intergenic
1174421437 20:50401569-50401591 TGGAGAAAAAAGGCCCAGAGAGG + Intergenic
1174463559 20:50699866-50699888 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1174500054 20:50977714-50977736 TGGGGCAGAGAAGCCCAGAGGGG - Intergenic
1174575168 20:51532222-51532244 GGGGAAAATGAGGCTCAGAGAGG + Intronic
1174578873 20:51556837-51556859 TGAGGAAAGGAGCCCCGGATAGG + Intronic
1174594260 20:51670818-51670840 TGAGGAAATGTGGCCCAGAGAGG - Intronic
1174759381 20:53192121-53192143 AGGGAAATGGAGGCTCAGAGTGG + Intronic
1175218991 20:57406271-57406293 GGGGGAAATGAGGCTCAGGGAGG - Intronic
1175803327 20:61813463-61813485 TGGGGACCTGAGGCTCAGAGAGG + Intronic
1175853810 20:62108145-62108167 TGGGGAAGGAAGGGCCAGGGAGG + Intergenic
1175963425 20:62648352-62648374 TGGGGAAAGGATGGGCCGAGAGG + Intronic
1175964342 20:62653015-62653037 TAGGGGAAGAAGGCCCAGGGGGG - Intronic
1176070479 20:63223625-63223647 TGTGGAAGGGAGCGCCAGAGGGG + Intergenic
1176196360 20:63837886-63837908 AGGGGGCAGGAGGGCCAGAGAGG + Intergenic
1176958824 21:15136837-15136859 TGAGGAAAGGAGGCACTGAAGGG + Intergenic
1177404366 21:20646104-20646126 AGTGGAGAGGAGACCCAGAGTGG - Intergenic
1178027944 21:28489427-28489449 GGGTGAAAGGAGGCTGAGAGTGG + Intergenic
1178409532 21:32351905-32351927 GGGGAAACCGAGGCCCAGAGCGG - Intronic
1178602068 21:34003146-34003168 TGAGGAAAGGAGGCCCAGAATGG + Intergenic
1178684093 21:34697757-34697779 TGGAGAAAGGAGCCCCTGACAGG + Intronic
1179120929 21:38544969-38544991 TGGAGAAAGAAGACCAAGAGCGG - Intronic
1179171121 21:38973619-38973641 TGGAGAAAGGAGGCCCTGGCAGG + Intergenic
1179907996 21:44434116-44434138 TGGGGAGAGGAGGCCATGAGGGG + Intronic
1180116487 21:45709046-45709068 GGGGAAACGGAGGCCCAGAAAGG - Intronic
1180273809 22:10628284-10628306 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
1180674918 22:17580603-17580625 ACGGGAATGCAGGCCCAGAGAGG + Intronic
1180705716 22:17808615-17808637 TGGGAAATGGCAGCCCAGAGGGG + Intronic
1180794363 22:18594827-18594849 TGGGAAAATGAGGCTCAGAGAGG + Intergenic
1180953671 22:19731799-19731821 TGTGGAAGGGGCGCCCAGAGCGG - Intergenic
1181001124 22:19988226-19988248 GGGGGAACTGAGGCTCAGAGGGG - Intronic
1181227377 22:21400493-21400515 TGGGAACATGAGGCTCAGAGAGG - Intergenic
1181251273 22:21534346-21534368 TGGGAACATGAGGCTCAGAGAGG + Intergenic
1181508237 22:23376135-23376157 TGGAAAATGGAGGCCCAGAGAGG - Intergenic
1181553911 22:23656503-23656525 AGGAGAAGGGAGGCCCAGTGTGG + Intergenic
1181599371 22:23940261-23940283 TGAGGAAATGAGGCCCAGAGAGG - Intergenic
1181609136 22:24001042-24001064 TGAGGAAATGAGGCCCAGAGAGG + Intergenic
1181646555 22:24234363-24234385 TGGGGAGTGGAGTCCCAGGGTGG - Intronic
1181677669 22:24467304-24467326 TGGGAAACTGAGGCCCAGAGAGG - Intergenic
1181757135 22:25032040-25032062 GGGGAAAACGAGGCCCAAAGAGG + Intronic
1181790935 22:25265813-25265835 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181826742 22:25522852-25522874 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181952532 22:26564757-26564779 GGGGAAATTGAGGCCCAGAGAGG + Intronic
1182004122 22:26944868-26944890 TTGGAAACAGAGGCCCAGAGAGG + Intergenic
1182010231 22:26994683-26994705 TGGGGAAGGGCTGCCCAGACAGG + Intergenic
1182059826 22:27388842-27388864 TGGGAAATGAAGGCTCAGAGAGG - Intergenic
1182064088 22:27417965-27417987 AGGTGAAAGAAGCCCCAGAGAGG - Intergenic
1182100474 22:27654339-27654361 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1182167474 22:28190860-28190882 AGAGAAAAAGAGGCCCAGAGTGG - Intronic
1182246451 22:28961701-28961723 TGAGAAATGGAGGTCCAGAGGGG + Intronic
1182283722 22:29232199-29232221 GGAGGCAAGGAGGCCCAGGGTGG - Intronic
1182311002 22:29406439-29406461 TAGGGAACTGAGGCACAGAGGGG + Intronic
1182362088 22:29752594-29752616 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1182370704 22:29808411-29808433 TGGGCAACTGAGGCCCAGATAGG + Intronic
1182416509 22:30224723-30224745 TGAGGAACTGAGGCTCAGAGAGG + Intergenic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1182451874 22:30426573-30426595 TCGGAAAGGGAGGCTCAGAGAGG + Intronic
1182540755 22:31040055-31040077 TGAGAAAAGGATGCTCAGAGAGG - Intergenic
1182542980 22:31055265-31055287 AAGGAAAAGGAGGCCCAGAGAGG - Intergenic
1182547865 22:31085999-31086021 GAGGGTAAAGAGGCCCAGAGGGG - Intronic
1182560239 22:31153829-31153851 TGGGTACAGGAGGCTGAGAGAGG - Intergenic
1182674988 22:32032167-32032189 TGGGACAGGGAGGCCCAGGGAGG + Intergenic
1182690106 22:32154664-32154686 TAGGGAACTGAGGCACAGAGGGG - Intronic
1182692536 22:32174072-32174094 TGGGAAAATGAGGCTCAGAGAGG - Intergenic
1182896908 22:33866561-33866583 TGAGGAAATGAGGCACAGAGAGG - Intronic
1182912412 22:33996132-33996154 AGGGCAAAAAAGGCCCAGAGTGG + Intergenic
1182925764 22:34123121-34123143 TGGGGAAGCGAGGCAAAGAGGGG + Intergenic
1183023310 22:35044528-35044550 GAGGAAAAGGAGGTCCAGAGAGG - Intergenic
1183212341 22:36458628-36458650 AGGGAAATGGAAGCCCAGAGAGG - Intergenic
1183253361 22:36745476-36745498 TGAGGCAGGGAGGCTCAGAGAGG - Intergenic
1183343881 22:37296330-37296352 AAGGAAATGGAGGCCCAGAGTGG - Intronic
1183397375 22:37579788-37579810 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1183440940 22:37822817-37822839 AGGGAAATTGAGGCCCAGAGAGG - Intergenic
1183458139 22:37933812-37933834 TGGGAAGTGGAGGGCCAGAGAGG + Intronic
1183468212 22:37990750-37990772 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1183528559 22:38339055-38339077 TGAGGAAAGGAGGGTCTGAGAGG + Intronic
1183588440 22:38766544-38766566 TGGAGAACAGAGGCCCAGAGAGG - Intronic
1183649891 22:39147760-39147782 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1183671421 22:39275012-39275034 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1183734682 22:39637228-39637250 TGGGGCCTGGAAGCCCAGAGCGG + Intronic
1183947913 22:41337436-41337458 TGAGTGAAGCAGGCCCAGAGTGG + Intronic
1184108721 22:42383228-42383250 TGGGGGAGGCAGGCCCAGTGAGG + Exonic
1184239344 22:43203766-43203788 TGGGGAAGGGAGGCAGAGGGAGG + Exonic
1184255800 22:43286107-43286129 TGAGGAAATGAGGCCCTGAGAGG - Intronic
1184263381 22:43332619-43332641 TGGGGAAACTGGGTCCAGAGAGG - Intronic
1184264657 22:43340628-43340650 TGAGGAAATGAGGCCCAGTGAGG + Intronic
1184266647 22:43350608-43350630 TGTGGAAATGTGGCACAGAGAGG + Intergenic
1184301607 22:43564033-43564055 TGGAGGACGGAAGCCCAGAGAGG - Intronic
1184333069 22:43838148-43838170 AAGGGAAAGGTGGCCCAGCGGGG + Intronic
1184403890 22:44289192-44289214 TGAGGAAATGAGACCCAGAGAGG + Intronic
1184496522 22:44845560-44845582 AAGGGAATGGAGGCCCAGAGAGG - Intronic
1184566230 22:45293798-45293820 GGGGAAACTGAGGCCCAGAGGGG + Intronic
1184598356 22:45527746-45527768 TGTGGACAGGGGGCTCAGAGAGG + Intronic
1184606686 22:45578517-45578539 GGGGAAACTGAGGCCCAGAGTGG - Intronic
1184656196 22:45943414-45943436 TGGGGACAGCAGGCTCCGAGTGG + Intronic
1184695558 22:46137106-46137128 GGGGACATGGAGGCCCAGAGGGG - Intergenic
1184833909 22:47009129-47009151 TGGGGAAACAAGGGCTAGAGTGG - Intronic
1184902941 22:47458702-47458724 TGAGGAAAGGGGGGCCAGTGAGG - Intergenic
1185129036 22:49027261-49027283 TGGGGAAGGGAGGAGGAGAGAGG - Intergenic
1185172997 22:49304353-49304375 GGGGGAAACGAGGCCCAGCAGGG + Intergenic
1185384800 22:50526740-50526762 TGCGGAGAGGAGGCTCAGCGTGG + Intronic
949169210 3:978589-978611 GGAGAAAAAGAGGCCCAGAGTGG + Intergenic
950013857 3:9742716-9742738 GAGGAAAAGTAGGCCCAGAGAGG + Intronic
950045060 3:9944157-9944179 TGGGAAAGTGAGGCTCAGAGAGG - Intronic
950098137 3:10342039-10342061 GGGGAAACAGAGGCCCAGAGAGG - Intronic
950105543 3:10386144-10386166 TGGGGAGAGCAGGGCCTGAGGGG + Intronic
950153565 3:10706951-10706973 AAGGGACATGAGGCCCAGAGAGG - Intronic
950159406 3:10748557-10748579 CGGGGAAATGACACCCAGAGAGG + Intergenic
950396090 3:12735129-12735151 TAGGAAAATGAGGCTCAGAGAGG - Intronic
950453982 3:13081808-13081830 GAGGGAAAGCAGGCTCAGAGAGG - Intergenic
950517132 3:13474738-13474760 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
950529952 3:13547714-13547736 TGAGGAAATAAAGCCCAGAGAGG + Intergenic
950577765 3:13843016-13843038 TGGATAAAGGAGGACCAGCGTGG + Intronic
950620784 3:14203549-14203571 TGAGGAATGGAAGCCCAGAATGG - Intergenic
950644377 3:14368316-14368338 TGGGGCAGGGTGGCGCAGAGGGG + Intergenic
950676618 3:14558042-14558064 TGGGGATGGGAGGCCCAGTGAGG + Intergenic
950864845 3:16180936-16180958 TGAGGAACTGAGGCTCAGAGAGG - Intronic
951165811 3:19484188-19484210 TGGACATGGGAGGCCCAGAGGGG + Intronic
952884347 3:38003349-38003371 GGAGGAATTGAGGCCCAGAGAGG + Intronic
952948392 3:38496675-38496697 TGGGGAAGGGAGGCCGAGCCGGG - Intronic
953143338 3:40249688-40249710 TAGGAAAATGATGCCCAGAGAGG + Intronic
953225306 3:41013504-41013526 TGGGGAAATGAGGCAGGGAGGGG + Intergenic
953372961 3:42405811-42405833 GGGGAAACTGAGGCCCAGAGAGG - Intronic
953672285 3:44973370-44973392 TTGGGAAATGAGGCACAGAGAGG - Intronic
953686152 3:45079835-45079857 TGGTGAAAGAAGGCCCAGCAAGG - Intergenic
953707950 3:45245397-45245419 TGGGGAAAGCAGGACCAGGAAGG + Intergenic
954202280 3:49030846-49030868 TGTGGGAAGGAGGGGCAGAGGGG - Intronic
954306085 3:49726204-49726226 TGGGGAAATGAGACCCTGAGCGG + Exonic
954455764 3:50599015-50599037 TGGGAAACTGAGGCTCAGAGTGG + Intergenic
954462448 3:50635040-50635062 GGGGAAACAGAGGCCCAGAGAGG + Intronic
954516125 3:51178928-51178950 TGAGGAAACAAGGCACAGAGTGG + Intronic
954687038 3:52376688-52376710 GGTGGGAAGGGGGCCCAGAGAGG - Intronic
954694304 3:52412594-52412616 TGGGGGACTGAGGCACAGAGAGG - Intronic
954800765 3:53185828-53185850 TGGGGGAAGGGGCCTCAGAGAGG - Intronic
954839209 3:53495848-53495870 TGGGGAGGGGAGCCCCACAGCGG - Intronic
955000589 3:54923801-54923823 TGGGCAACAGAGTCCCAGAGAGG - Intronic
955245342 3:57219655-57219677 TGGGCAAAGGAGGCCAGGTGCGG - Intronic
955437593 3:58918802-58918824 GAGGAAAAGGAGGCCCAGAGAGG - Intronic
956295950 3:67713814-67713836 TGGGGGAAAGAGGCCATGAGTGG + Intergenic
956668173 3:71661489-71661511 TGGGAAATGGAGGCCCAAGGAGG - Intergenic
956673145 3:71710047-71710069 TGGGGAACAGAGGCACAGAGAGG + Intronic
956735057 3:72231925-72231947 TGAGGAAATGACGCCCAGGGAGG - Intergenic
956900668 3:73712720-73712742 TAGCAAATGGAGGCCCAGAGAGG + Intergenic
956909860 3:73806354-73806376 GGGGAAAGTGAGGCCCAGAGAGG + Intergenic
957678797 3:83404643-83404665 AGCGGAAAGGAGGCCCTGAGAGG - Intergenic
958019633 3:87980354-87980376 AGTGGAGAGGAGACCCAGAGTGG + Intergenic
958952317 3:100429802-100429824 TGGAGAGAGGAGGATCAGAGAGG + Exonic
959532346 3:107447915-107447937 TGTGGAAAGTAGACCTAGAGTGG - Intergenic
959549642 3:107640127-107640149 TGAGGAATAGAGGCTCAGAGAGG + Intronic
959768374 3:110061604-110061626 TAGGAAACTGAGGCCCAGAGAGG + Intergenic
959769815 3:110080285-110080307 TGGGTAAAGAATGCCCAGATGGG + Intergenic
960583081 3:119296820-119296842 GGGGGAAAAGAAGCCCAGAGGGG + Intronic
960868966 3:122230513-122230535 TGGGGGATGGTGGCGCAGAGAGG - Intronic
960893835 3:122480160-122480182 TGGGGAAAGGAGGGACAAATAGG + Intronic
960950513 3:122995848-122995870 TGAGAAATGGAGGCTCAGAGTGG - Intronic
961247313 3:125466634-125466656 TGGGCAAAGGAGGCCAGGCGTGG + Intronic
961325876 3:126109037-126109059 GAGGCAGAGGAGGCCCAGAGTGG + Intronic
961457674 3:127032253-127032275 CGGGGAAACGAGGCCCACAGAGG - Intronic
961530235 3:127536134-127536156 AAGGGCAAGGAGGCCCAGTGCGG - Intergenic
961654715 3:128434990-128435012 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
961745411 3:129061155-129061177 GGGGAAACTGAGGCCCAGAGAGG - Intronic
961926205 3:130483621-130483643 TTGGGGAGGGAGGCCCAGAAGGG + Intronic
962093814 3:132272905-132272927 TGAGGAAAGAAGGCTCAGAGAGG - Intronic
962197254 3:133375018-133375040 TGAGGAAAAGAAGCACAGAGAGG - Intronic
962291913 3:134144781-134144803 TGGGGACAGGAGGCCCAAACAGG + Intronic
962402648 3:135074707-135074729 GGGGAAACTGAGGCCCAGAGGGG - Intronic
962803596 3:138910842-138910864 CGGGGACAGGAAGCACAGAGTGG + Intergenic
963250220 3:143095938-143095960 AGTGGAAAGGAGACCCACAGTGG - Intergenic
963257949 3:143164600-143164622 TAAGGAAAGCAGGCCCAGAAAGG - Intergenic
964526148 3:157616807-157616829 TGGGGAAAGCTGGGCCTGAGGGG - Intronic
964539247 3:157761007-157761029 TAGGAAAGGGAGGCTCAGAGAGG + Intergenic
964615819 3:158664054-158664076 TGAGGAAATGAGGTACAGAGAGG - Intronic
965229198 3:166029154-166029176 AGTGGAGAGGAGACCCAGAGAGG + Intergenic
965460003 3:168950873-168950895 TGAGAAAATGAGGCTCAGAGAGG - Intergenic
966002381 3:174966121-174966143 TGAGGAAAGGAAGACCAGTGGGG - Intronic
966247324 3:177823989-177824011 TGATGAACTGAGGCCCAGAGAGG - Intergenic
966640381 3:182183277-182183299 ACGGGAAATGAGGCACAGAGAGG + Intergenic
966780865 3:183583090-183583112 TTGGCAGATGAGGCCCAGAGAGG + Intergenic
966940513 3:184743383-184743405 TGAGGAAATGAGGCCCAGAGAGG + Intergenic
967144401 3:186594155-186594177 TTGGGTGAGGAGGCTCAGAGAGG - Intronic
967192692 3:186998925-186998947 TGAGGAAATGAAGCCCAGAGAGG + Intronic
967485496 3:190025480-190025502 GGGGAAAATGAGGCACAGAGAGG - Intronic
967700259 3:192584407-192584429 TGGAAAACAGAGGCCCAGAGAGG + Intronic
967834045 3:193945883-193945905 TGGGAAACGGAGGCCCGGAGAGG + Intergenic
967924014 3:194632737-194632759 CGGTCATAGGAGGCCCAGAGAGG + Intronic
967931865 3:194695752-194695774 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
967978316 3:195047884-195047906 TGGGAAATTGAGGCCCAGAGTGG + Intergenic
968142923 3:196273563-196273585 AGCGGAGAGGAGACCCAGAGTGG + Intronic
968266539 3:197367479-197367501 TGGGGAGAAGGGGTCCAGAGGGG + Intergenic
968278557 3:197458836-197458858 TGGGGAAAAAAGGCCCTGTGTGG - Intergenic
968284084 3:197498118-197498140 TGGGGAAATGAAGCTCAAAGAGG + Intergenic
968487043 4:867773-867795 TGGGCCAAGGAGGCGCTGAGGGG - Intronic
968622753 4:1611076-1611098 TGGGGAATGGGGGCACAGAACGG + Intergenic
968816844 4:2825970-2825992 TGGGGACAGGAGGCCCAGGGAGG + Intronic
968838312 4:2981538-2981560 AGTGGAAAGGAGACCCACAGTGG + Intronic
968948189 4:3676497-3676519 TGGGAAATGGAGACCCAGAGTGG - Intergenic
969099060 4:4755293-4755315 GGGGAAACTGAGGCCCAGAGGGG + Intergenic
969203456 4:5623801-5623823 AGGGAAATGGAGGCGCAGAGAGG - Intronic
969231947 4:5838268-5838290 AGGGCAGAGGAGGCCCAGGGAGG + Intronic
969376057 4:6763926-6763948 TGGGGAATAGAGGCGCATAGAGG - Intergenic
969378593 4:6779608-6779630 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
969498030 4:7537204-7537226 GGGGAAACTGAGGCCCAGAGAGG - Intronic
969521711 4:7681850-7681872 TGGGAAACTGAGGCTCAGAGGGG - Intronic
969531847 4:7734694-7734716 TGAGGAAACCAGGCTCAGAGAGG + Intronic
969586826 4:8098710-8098732 GAGGACAAGGAGGCCCAGAGAGG - Intronic
969682455 4:8650887-8650909 TGGGAAGAGAAGGCACAGAGTGG + Intergenic
969685860 4:8673734-8673756 GGGCCAACGGAGGCCCAGAGGGG - Intergenic
969703429 4:8780025-8780047 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
970637801 4:18028563-18028585 TAGGGAAATTGGGCCCAGAGAGG + Intergenic
970681312 4:18511749-18511771 TGGGCAAAGAAGGGACAGAGAGG + Intergenic
970823759 4:20250968-20250990 GGGGGAAAGGGGGGCGAGAGAGG + Intergenic
970860780 4:20700444-20700466 TGGGGAAATGAGGCTCCGCGCGG - Exonic
971025094 4:22581985-22582007 GGGGGCATGGAGGACCAGAGTGG - Intergenic
971343678 4:25793104-25793126 GTGGAAACGGAGGCCCAGAGAGG + Intronic
971385868 4:26140058-26140080 TGGGAACTGGAGGCCCAGAGAGG - Intergenic
971418859 4:26457358-26457380 TGAAGAAATGAGGCTCAGAGAGG - Intergenic
972052992 4:34764328-34764350 GGGGGCAAGGAGGGCCAGGGTGG - Intergenic
972762081 4:42116447-42116469 GGGGTAAAGGAGGCACGGAGGGG + Exonic
972788222 4:42346723-42346745 AGTGGACAGGAGACCCAGAGTGG - Intergenic
973804076 4:54508434-54508456 TGGGGAAAAGAGGCAGGGAGTGG - Intergenic
975042744 4:69763873-69763895 GGGGCAATGGAGGCACAGAGAGG - Intronic
975394027 4:73853941-73853963 TGGGCAGAGGAGGCACGGAGCGG - Intronic
975405202 4:73981363-73981385 TGGGCAGAGGAGGCACGGAGCGG + Intronic
976250490 4:83046022-83046044 GAGGAAAAGGAGGCACAGAGAGG - Intronic
976559760 4:86488030-86488052 AGAGGAGAGGAGGCCCAGATGGG + Intronic
977918080 4:102615299-102615321 TTGGGAATGGAGGCGCAGTGTGG - Intronic
978072749 4:104491983-104492005 TGTGGAAATGAGCCCCAGAGAGG - Exonic
978621403 4:110637354-110637376 TGTGGAAAGGAGGACCAGAAGGG + Intronic
979637865 4:122977998-122978020 AGTGGAGAGGAGACCCAGAGTGG + Intronic
980098051 4:128513216-128513238 TGGGTCATGGAAGCCCAGAGAGG - Intergenic
980130337 4:128811527-128811549 TGAGGAGAGGCGGCCCAGTGTGG + Intronic
981449317 4:144878508-144878530 TGGTGGAAGTAGGCCTAGAGTGG - Intergenic
981816109 4:148832539-148832561 TAGGGAAATGATGCACAGAGAGG + Intergenic
982094911 4:151912715-151912737 AGGGGAATGGAGGCTGAGAGCGG + Intergenic
982109492 4:152040787-152040809 TTGGAAATGGAGGCACAGAGAGG - Intergenic
982181379 4:152751405-152751427 AGTGAAGAGGAGGCCCAGAGTGG - Intronic
982181442 4:152751742-152751764 AGGGGAGAGGAGACCCTGAGTGG - Intronic
982551222 4:156802075-156802097 AGGGGAAAGGTGGGCTAGAGGGG - Intronic
982957734 4:161792651-161792673 AGGGGAGAGGAGACCCACAGTGG - Intronic
983260234 4:165448388-165448410 TGGGGAACTGAGGCTCAGATTGG + Intronic
983698420 4:170561355-170561377 TGCAGAAAGCAGGGCCAGAGAGG - Intergenic
983885378 4:172975287-172975309 AGTGGAGAGGAGACCCAGAGTGG + Intronic
983943940 4:173565298-173565320 TGGGGGAAGGTGGCTGAGAGTGG + Intergenic
984323378 4:178222891-178222913 TGGGGAAAGGAAGGCTAGAAGGG + Intergenic
984344008 4:178497101-178497123 TGGGGAAGGGAGGTGCAGTGGGG + Intergenic
985927328 5:3028410-3028432 TGGGGGCAGGGGGCACAGAGGGG - Intergenic
987434737 5:17881307-17881329 GGGGGAAAGGTGGGACAGAGAGG - Intergenic
988940429 5:36139743-36139765 AGTGGAGAGGAGCCCCAGAGTGG - Intronic
989141719 5:38208046-38208068 GTGGGAAAGGAGGCCAAGGGAGG - Intergenic
989789358 5:45378127-45378149 TGAGGAAAAGAAACCCAGAGAGG + Intronic
989991121 5:50767403-50767425 TGATGACAGGAGGCACAGAGGGG + Intronic
990513950 5:56514988-56515010 GGGGGAAACTAGGCCCAGAGTGG + Intronic
991247110 5:64520298-64520320 AGGGGAAAGGAGACTCTGAGTGG - Intronic
991922384 5:71669582-71669604 TGGAGAAATGAGGCTCAGATGGG - Intergenic
992184162 5:74227613-74227635 ATGGAAATGGAGGCCCAGAGAGG - Intergenic
992248275 5:74851221-74851243 TGGAGGAAGGAGGCCCTAAGGGG - Intronic
992392600 5:76342704-76342726 TGAGGAATTGAGGCCCAGAGAGG - Intronic
992871121 5:81006681-81006703 TGGGGAAAGGGGGATCCGAGAGG - Intronic
993065607 5:83094347-83094369 AGGGGAAAGGAGGGGAAGAGAGG - Intronic
993841787 5:92889448-92889470 TGGGCATAGCATGCCCAGAGAGG - Intergenic
993855166 5:93065599-93065621 TGGGGAAAGGAGAGCAATAGGGG + Intergenic
994368975 5:98947673-98947695 GGAGGAAAGCAGGCACAGAGCGG - Intergenic
994406528 5:99352469-99352491 TGTGGAGCGGAGACCCAGAGTGG + Intergenic
994916252 5:105983059-105983081 TGCAGAGAGGAGACCCAGAGTGG - Intergenic
995024721 5:107406708-107406730 TGGGGACAGGAGGCTGGGAGGGG - Intronic
995064512 5:107844717-107844739 GAGGGAAAGCAGGGCCAGAGTGG + Intergenic
995222767 5:109669559-109669581 TGAGGAAACGGGGCCCAGAGAGG - Intergenic
995386659 5:111596350-111596372 AGTGGAGAGGAGACCCAGAGTGG - Intergenic
996887265 5:128372125-128372147 AGAGGAAAGGAGGAACAGAGAGG + Intronic
997459908 5:134044920-134044942 TGGGGAAGGGAGGCCTAGGCAGG + Intergenic
997611672 5:135220031-135220053 TGGGCAAGCGAGGCCCATAGAGG - Intronic
997711505 5:136008549-136008571 TGGGGCAGGGAGGAACAGAGTGG + Intergenic
997766243 5:136506402-136506424 TAGGGGAAGGAGGTTCAGAGTGG + Intergenic
998112721 5:139514506-139514528 TAGGAAACTGAGGCCCAGAGAGG - Intergenic
998189274 5:140008874-140008896 TGGGGAACTGAGACACAGAGAGG - Intronic
998385675 5:141755940-141755962 AGGGAAATGGAGGCCCAGAGAGG - Intergenic
998458050 5:142288982-142289004 GAGGAAAAGGAGGACCAGAGAGG - Intergenic
998472910 5:142397270-142397292 TAAGGAAAGGAGGCCCACAGAGG + Intergenic
998528790 5:142866379-142866401 TGGGAAACTGAGGCTCAGAGAGG - Intronic
998593107 5:143498986-143499008 TGAGGAAACTAGGCACAGAGAGG + Intergenic
998772617 5:145563516-145563538 TGAGGAACTGAGGTCCAGAGAGG + Intronic
999107743 5:149088640-149088662 TGGGTAAAGCTGGCCCAGAAAGG + Intergenic
999169584 5:149581844-149581866 TGGGAAACTGAGGCCCAGGGAGG + Intronic
999180210 5:149664894-149664916 GGGTGAAGGGAGGGCCAGAGTGG + Intergenic
999208609 5:149868385-149868407 AGGGAAATGGAGGCTCAGAGAGG - Intronic
999230413 5:150058541-150058563 TGGGGAAAGTATTCCCAGAGTGG - Intronic
999238641 5:150114822-150114844 GGGGAAACTGAGGCCCAGAGAGG + Exonic
999239365 5:150118615-150118637 AGGGAAACTGAGGCCCAGAGAGG + Intronic
999243274 5:150139651-150139673 GGGGAAACTGAGGCCCAGAGAGG - Intronic
999261321 5:150240679-150240701 TGAGAAACTGAGGCCCAGAGAGG + Intronic
999263653 5:150252812-150252834 TGAGGAACGAAGGCACAGAGAGG + Intronic
999265095 5:150261790-150261812 TTTGGAAGGGAGGCTCAGAGAGG - Intronic
999297090 5:150466415-150466437 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
999330993 5:150673192-150673214 GGGGCAATGGAGGCTCAGAGAGG - Intronic
999364147 5:151010687-151010709 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
999383166 5:151136013-151136035 GGCAGGAAGGAGGCCCAGAGAGG + Intronic
999411191 5:151351212-151351234 TGGGAAACTGAGGCCCAGATAGG + Intergenic
999411419 5:151353264-151353286 TGTGAAACTGAGGCCCAGAGAGG + Intergenic
999443004 5:151616976-151616998 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
999460087 5:151750185-151750207 GGGGAAACTGAGGCCCAGAGAGG - Intronic
999493238 5:152072095-152072117 TGAGGAAAAAAGACCCAGAGAGG + Intergenic
999497657 5:152115863-152115885 TGAGGAAATGTGGCCCACAGAGG - Intergenic
999702820 5:154243972-154243994 TGAGGATAAGAGGCCCAGACAGG + Intronic
999726844 5:154445306-154445328 GGGGGAAAGGAGACCCCGAGGGG - Intergenic
999770703 5:154773549-154773571 TGGGGGAAGCAGGCACAGATAGG + Intronic
999889955 5:155966648-155966670 GGGAGAAATGAGGCTCAGAGAGG - Intronic
1000146788 5:158461269-158461291 TGGAGGAGGGAGGCCCAGAGAGG + Intergenic
1000245570 5:159446138-159446160 TAGGAAAATGAGGCACAGAGAGG + Intergenic
1000295778 5:159912219-159912241 TGAGGAAACTGGGCCCAGAGTGG + Intergenic
1000462063 5:161535615-161535637 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1001041090 5:168335967-168335989 TGAGGAAACGAGGACCAGAGAGG - Intronic
1001127391 5:169032071-169032093 GGGGAAAATGAGGGCCAGAGGGG - Intronic
1001130121 5:169056930-169056952 TGAGAAAATGAGGCTCAGAGAGG - Intronic
1001155444 5:169268976-169268998 TGGGAAAGTGAGGTCCAGAGAGG + Intronic
1001412754 5:171522439-171522461 AGGGAAATGGAGGCACAGAGAGG - Intergenic
1001559007 5:172657195-172657217 TAGGGACATTAGGCCCAGAGAGG - Intronic
1001710194 5:173772267-173772289 TAGGCAAATGAGGCTCAGAGAGG - Intergenic
1001778100 5:174344297-174344319 CTGGAAATGGAGGCCCAGAGAGG - Intergenic
1001795013 5:174494842-174494864 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1001861920 5:175063359-175063381 TTGGGAAAGGAGGCACAGGAAGG - Intergenic
1001926312 5:175639727-175639749 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1002024759 5:176389252-176389274 TGGGGAAGCGAGACCCAAAGCGG + Intronic
1002053741 5:176586557-176586579 GCGGAAATGGAGGCCCAGAGAGG - Intronic
1002053923 5:176587632-176587654 AGGGAAACGGAGTCCCAGAGAGG - Intronic
1002181163 5:177431802-177431824 TGGGGCTGTGAGGCCCAGAGAGG - Intronic
1002277949 5:178115316-178115338 TAGGCAAGGGGGGCCCAGAGAGG - Intronic
1002459673 5:179367110-179367132 AGGGAAACCGAGGCCCAGAGGGG - Intergenic
1002563526 5:180097955-180097977 TGGGGAACAGAGGCTCAGAAAGG - Intergenic
1002654666 5:180735236-180735258 TGGGCAAAGGCGGCCCGGTGCGG - Intergenic
1003232251 6:4265062-4265084 TGAGGAACTGAGGCACAGAGAGG - Intergenic
1003325000 6:5084793-5084815 TGGGGAAAGCAGGAGCAGAAGGG + Exonic
1003449787 6:6219996-6220018 AGGAGAAAAGAGGCACAGAGAGG + Intronic
1004174901 6:13331138-13331160 TGGGGAAAGTAGCCTCAGGGAGG - Intergenic
1004268803 6:14175444-14175466 AGGGAAATTGAGGCCCAGAGAGG - Intergenic
1004305624 6:14499480-14499502 TGAGGAAATTAGGACCAGAGAGG + Intergenic
1004498948 6:16191832-16191854 TTTGTAAAGAAGGCCCAGAGAGG - Intergenic
1004882920 6:20026468-20026490 TGGGAAACTGAGGCTCAGAGAGG - Intergenic
1005275396 6:24211595-24211617 AAGAGGAAGGAGGCCCAGAGTGG + Intronic
1005998414 6:30946555-30946577 TGGGGAAAGGAGACGCAAAGAGG - Intronic
1006102242 6:31692839-31692861 TGAAGAAAAGAGGCTCAGAGAGG - Intronic
1006316473 6:33294871-33294893 TGGGTAAGGGAGGCACAGAGGGG - Intronic
1006436794 6:34029887-34029909 GAGGGGAAGGAGGCCGAGAGTGG + Intronic
1006438921 6:34041268-34041290 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1006447694 6:34089045-34089067 TGGGGAAATGGAGGCCAGAGGGG - Intronic
1007083327 6:39124576-39124598 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1007278375 6:40692157-40692179 TAGAAAATGGAGGCCCAGAGAGG + Intergenic
1007325242 6:41054446-41054468 GGGGGAAAGGAAGCCCTGAGTGG + Intronic
1007341564 6:41194174-41194196 AGGGGAAAGGAGGGTCAGTGGGG - Intronic
1007394522 6:41569986-41570008 TGGGCAGAGGAGGCCCAGATGGG - Intronic
1007498102 6:42275624-42275646 TAGGCAAAGGAGACCTAGAGTGG + Intronic
1007632268 6:43279087-43279109 TGGGAAACTGAGGCACAGAGAGG - Intronic
1007696958 6:43740213-43740235 TGGGGAACTGAGGCCCAAAGAGG - Intergenic
1007724724 6:43908294-43908316 TGGGGAAATGAGGCTCAGAGAGG - Intergenic
1007744754 6:44036689-44036711 TGGGGACAGGAGAGCCAGAGAGG + Intergenic
1007783587 6:44267889-44267911 TGGGAAACTGAGGCCCAGAGAGG + Intergenic
1007848348 6:44779918-44779940 TGAGAAACGGAGGCCCAGAGAGG + Intergenic
1008487824 6:52054530-52054552 TGAGGAACTGAGGCTCAGAGAGG - Intronic
1008487991 6:52055883-52055905 TGAGGAACTGAGGCTCAGAGAGG - Intronic
1008877054 6:56340520-56340542 TGGGGAGAGGAGGACCAGCTAGG + Intronic
1009176592 6:60467484-60467506 GGGGGAAAACAGGCCCAGAGAGG - Intergenic
1009320913 6:62286865-62286887 TGGGGAAAGGAGGCACGGATAGG - Intergenic
1010017951 6:71126079-71126101 TGGGGGAAGGAAGCCTAGTGGGG + Intergenic
1010021560 6:71165515-71165537 TGTGGAAAGGAAGCCCAAAGTGG - Intergenic
1010378213 6:75199266-75199288 TGAGAAAATGAGGCCCAGAGAGG - Intronic
1011284142 6:85705973-85705995 AGTGGAGAGGAGGCCCACAGTGG + Intergenic
1011765055 6:90611201-90611223 TGGGGAAGGGACGCCAAGAGAGG - Intergenic
1011796259 6:90956262-90956284 TGAGGAACTGAGGCACAGAGTGG + Intergenic
1011852538 6:91647859-91647881 TGGGGGAGGGATGCCCAGAATGG + Intergenic
1011913594 6:92472982-92473004 GTGGGAAAGGAAGCCCAGAGGGG - Intergenic
1012399718 6:98833821-98833843 TGGGGAAAGAACCCCGAGAGAGG - Intergenic
1012503422 6:99916252-99916274 TGAGGAGAGGAGGCCCGGCGTGG + Intergenic
1012953848 6:105547428-105547450 ATGGGAAAACAGGCCCAGAGAGG - Intergenic
1012976175 6:105783489-105783511 TGAGGAAATGAAGCACAGAGAGG + Intergenic
1013297252 6:108768758-108768780 TGAGGAAATGAGACTCAGAGTGG + Intergenic
1013574701 6:111470423-111470445 TGAGGAAATGAGGCATAGAGAGG - Intronic
1013718550 6:112993959-112993981 TGGGGAAAGCCGGTCCAGACAGG - Intergenic
1014054103 6:116993248-116993270 ATGGGAAAGGAGGCCCAGTTAGG + Intergenic
1014160179 6:118158479-118158501 TGCTGATAGGTGGCCCAGAGTGG - Intronic
1014260394 6:119209871-119209893 TGGGGAAAGGTGGCTAATAGAGG + Intronic
1015181884 6:130369564-130369586 TGGGGAAAGGGGGACCTTAGAGG - Intronic
1015448168 6:133332409-133332431 TGGGAAAAGGAGGCACAGCAGGG - Intronic
1016163288 6:140908057-140908079 AGTGGAAAGGAGACCCACAGTGG + Intergenic
1016197607 6:141364984-141365006 TTGGGAAAGGAAGCCCACAGAGG + Intergenic
1016690295 6:146930175-146930197 TGGGGTCAGGAAGACCAGAGAGG + Intergenic
1016996525 6:149965350-149965372 GGCGGAAAGGAGCCCCGGAGGGG - Intronic
1017024944 6:150173406-150173428 TGGGGAAGGGAGTCCAGGAGAGG - Intronic
1017705508 6:157119241-157119263 TGGGGACAGGAGGAACAGCGAGG - Intronic
1017888446 6:158620201-158620223 TGGTGAGAGGAGGCCCGGGGGGG + Intronic
1018065531 6:160122857-160122879 TGAGGAAATGAGGCTTAGAGAGG - Intronic
1018068294 6:160139200-160139222 GAGGGAACTGAGGCCCAGAGAGG + Intronic
1018181691 6:161228679-161228701 TAGGGAAAGGTGGCCAAGACTGG - Intronic
1018312760 6:162527914-162527936 TGGTGGAAGGAGGCCCAGGCTGG - Intronic
1018840452 6:167512763-167512785 TGGGGAAAGATGGTGCAGAGAGG + Intergenic
1018890227 6:167977371-167977393 AGGGGAGAGGAGGCCCCGGGTGG - Intergenic
1019287701 7:231851-231873 TGGGAAACTGAGGCCCAAAGAGG - Intronic
1019292447 7:257340-257362 TGGGAAACGGAGGCCAGGAGAGG + Intronic
1019312128 7:368006-368028 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019318267 7:401536-401558 AGGGAAATTGAGGCCCAGAGAGG - Intergenic
1019359342 7:596678-596700 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1019376935 7:697716-697738 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1019492809 7:1323050-1323072 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019494518 7:1331559-1331581 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019533051 7:1513218-1513240 GGGGGAACTGAGGCCCAGAGAGG - Intergenic
1019577262 7:1743545-1743567 GGGGAAACTGAGGCCCAGAGGGG + Intronic
1019613148 7:1947033-1947055 TGGGAAGCCGAGGCCCAGAGAGG - Intronic
1019700235 7:2471336-2471358 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019712174 7:2522738-2522760 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1019863133 7:3679274-3679296 TGGGCAAAGGAGGCCAGGTGCGG + Intronic
1020049826 7:5073939-5073961 TGGGGCCAGGAGGCTCAGTGTGG - Intergenic
1020414098 7:7925945-7925967 TGGTGAAAGCAGGAGCAGAGAGG - Intronic
1020503895 7:8959103-8959125 TGGGGAAATGAGACCCAGAGAGG - Intergenic
1020503999 7:8960422-8960444 TGGGAAAATGAGACCCAGAGAGG - Intergenic
1021343094 7:19488847-19488869 AGTGGACAGGAGACCCAGAGTGG + Intergenic
1021730455 7:23590476-23590498 TGGGAAACGGAGGCTTAGAGAGG + Intergenic
1022031972 7:26499933-26499955 TGAGAAATGGAGGCTCAGAGAGG - Intergenic
1022124470 7:27342133-27342155 TGGGGAAGTGAGGCCAGGAGGGG - Intergenic
1022252927 7:28626855-28626877 TGGGGAAAGGGGCCCCAGGACGG + Intronic
1022264198 7:28737394-28737416 TGGGGAAATGAGGAACAGAGGGG - Intronic
1022340754 7:29465512-29465534 TGAGGAAATGAGGCACAAAGAGG + Intronic
1022494602 7:30844971-30844993 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1022505893 7:30908452-30908474 TGGGGGCTGCAGGCCCAGAGAGG - Intergenic
1022515976 7:30975189-30975211 TGGGATACTGAGGCCCAGAGAGG - Intronic
1022521091 7:31007334-31007356 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1022533650 7:31082564-31082586 AGAGGAAATGAGGCCCAGGGAGG + Intronic
1022728789 7:33003985-33004007 TGGGTAAAGCAGGCCCCAAGCGG - Intronic
1023116979 7:36872252-36872274 TGGGCAGAGGAGGCTCAGGGAGG + Intronic
1023157188 7:37262840-37262862 GGGGAAAATGAGGCCAAGAGAGG - Intronic
1023235867 7:38086085-38086107 TGGAGTAATGAGGACCAGAGTGG - Intergenic
1023302121 7:38784231-38784253 AGAGGGAAGGAGGCTCAGAGGGG + Intronic
1023571528 7:41577189-41577211 TGGGGGAAGGAGGATCCGAGGGG + Intergenic
1023616992 7:42029788-42029810 TGGGGCAAGGAGGTGCAGAGGGG - Intronic
1023663093 7:42490859-42490881 TGGGGAGAGGAGGAACAGATTGG - Intergenic
1023764533 7:43498322-43498344 CGGGAAAAAGAAGCCCAGAGAGG - Intronic
1023835673 7:44065866-44065888 TGGGGATAGCAGGGACAGAGGGG + Intronic
1024194253 7:47043236-47043258 TGAAGAAAAGAGGCCAAGAGTGG + Intergenic
1024304100 7:47912452-47912474 TGGAGAAAGGTGACCCAGAGTGG + Intronic
1024428831 7:49262163-49262185 TGGGGAGAAGAGGCCCAGCTGGG + Intergenic
1024731812 7:52261454-52261476 TGGGCAAAGTAGCTCCAGAGTGG - Intergenic
1025044859 7:55684004-55684026 TGGGTAAAGCAGGCCCCAAGCGG + Intergenic
1025077038 7:55952211-55952233 TGGGGAGAGGCGACCCAGCGGGG + Intronic
1025115294 7:56252766-56252788 TGGGGAGAAGAGGCAAAGAGAGG + Intergenic
1025872960 7:65452268-65452290 TGGGAGAAGGAAGTCCAGAGAGG + Intergenic
1026052475 7:66958955-66958977 TTGGCAAAGGAGGTCTAGAGCGG - Intergenic
1026199688 7:68203602-68203624 TGGGGAGAAGAGGCAAAGAGAGG + Intergenic
1026387938 7:69869694-69869716 TGGGGTAAGGAGGCTAAAAGAGG + Intronic
1026612852 7:71875724-71875746 TGGGGTAAGGGGGCCCAGCTAGG + Intronic
1026762432 7:73137012-73137034 TAAGGAAATGAGGCACAGAGAGG + Intergenic
1026843506 7:73683970-73683992 TGAGGTACCGAGGCCCAGAGAGG - Intronic
1026868761 7:73838302-73838324 TGGGAAACTGAGGCCCAGAGAGG - Intronic
1026877569 7:73888222-73888244 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1026924138 7:74177905-74177927 GGGGAAAACGAGGCTCAGAGAGG - Intronic
1026963789 7:74426459-74426481 AGGGAAACGGAGGCCCAGAGAGG + Intergenic
1026996014 7:74617234-74617256 TGGGGACATGAGACCCAGAGGGG + Intergenic
1027038896 7:74946758-74946780 TAAGGAAATGAGGCACAGAGAGG + Intergenic
1027084792 7:75255678-75255700 TAAGGAAATGAGGCACAGAGAGG - Intergenic
1029392288 7:100283221-100283243 TAAGGAAATGAGGCACAGAGAGG - Intergenic
1029422176 7:100477464-100477486 TGGGGTGAGGAGGCCGACAGTGG + Exonic
1029451025 7:100641829-100641851 TGGGGGAAGGGGGCCGATAGTGG + Intronic
1029612660 7:101635628-101635650 TTTGGAAAGGAGGCCAAGAAAGG + Intergenic
1029624013 7:101708446-101708468 TAGGAAATGGAGGCTCAGAGAGG - Intergenic
1029656856 7:101931508-101931530 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1029693920 7:102201059-102201081 CGGGGAAAGGAGCCCCAGGAGGG + Intronic
1029706600 7:102279774-102279796 TGGGGAACTGAGGCCCAGGCAGG - Intronic
1029974700 7:104822041-104822063 AGCGGAAAGGAGGGGCAGAGGGG + Intronic
1030066973 7:105667214-105667236 TGGCCAAAGGAGACCCAGAGAGG + Intronic
1030243858 7:107359934-107359956 AGTGGAGAGGAGACCCAGAGTGG - Intronic
1031041498 7:116843095-116843117 TGGGGATAGGAGGCAGAAAGAGG - Intronic
1032402930 7:131636436-131636458 TGAGGAAAGGAGCCACAGATAGG + Intergenic
1032840858 7:135712436-135712458 TGAGAAAATGAAGCCCAGAGAGG - Intronic
1033266672 7:139892933-139892955 TAGGAAAATGAGGCCCAAAGAGG - Intronic
1033365382 7:140669621-140669643 TGGGGAACACAGGCTCAGAGAGG + Intronic
1033717818 7:144021104-144021126 TGAGGCAAGGAGGCCCTAAGAGG - Intergenic
1034393231 7:150801510-150801532 TGAGGAAGGGAGCACCAGAGAGG - Intronic
1034528964 7:151683703-151683725 GGGGGAACGGTGGCCCAGGGAGG + Intronic
1034935834 7:155200218-155200240 TGGGATACTGAGGCCCAGAGAGG - Intergenic
1035022322 7:155806966-155806988 TGGAGAAAGGGGCCCCAGAAGGG - Intronic
1035097365 7:156366263-156366285 TGAGGCATTGAGGCCCAGAGGGG - Intergenic
1035381879 7:158445716-158445738 TGGGGCCAGGAGACCCTGAGAGG + Intronic
1035425500 7:158769428-158769450 TGGGGTGAGGAGGCGCAGTGAGG - Intronic
1035756138 8:2034376-2034398 TGTGGAAATCAGGCCCAGACAGG - Intergenic
1036048103 8:5166518-5166540 GGGTGAAAGGGGGCCAAGAGAGG - Intergenic
1036219285 8:6907780-6907802 TTTGCAGAGGAGGCCCAGAGAGG + Intergenic
1036577231 8:10039579-10039601 GGGTGAGTGGAGGCCCAGAGAGG - Intergenic
1036693253 8:10958076-10958098 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1036749041 8:11431719-11431741 TGGGGAATGGGGGCCCAGCCTGG + Intronic
1036781679 8:11651974-11651996 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1036961016 8:13244587-13244609 TGTGGAAAGGAGGCCAAGAGTGG - Intronic
1037379428 8:18268637-18268659 TAGGGAAAGGAGGTTCAGAGGGG - Intergenic
1037603947 8:20421956-20421978 TGGTGAAGGTAGGCCCAGGGCGG - Intergenic
1037755153 8:21705710-21705732 TGGGGGAAGGAGGGCCCCAGGGG - Intronic
1037913366 8:22757542-22757564 GAGGAAAGGGAGGCCCAGAGAGG + Intronic
1037921523 8:22809601-22809623 TGAGAAATTGAGGCCCAGAGTGG - Intronic
1037946702 8:22994171-22994193 TGAGAAAGTGAGGCCCAGAGAGG + Intronic
1038664649 8:29527687-29527709 TGAGGAAAAGAGGCCCGGAGAGG + Intergenic
1038746531 8:30259801-30259823 TGAGGAAAGGAGGCACAGGGAGG - Intergenic
1039346189 8:36708263-36708285 TGTGGAACTGAGACCCAGAGGGG + Intergenic
1039856033 8:41415089-41415111 TAGGGAAAGGAGGGCCAGCGAGG + Intergenic
1039981485 8:42412602-42412624 TGGGGCAAGGAGGTCAAAAGAGG - Intergenic
1040063733 8:43127613-43127635 TGGGGAAAGGGATGCCAGAGGGG + Intergenic
1041062823 8:54052656-54052678 TGTGGAAAGGAAGCCCGAAGTGG + Exonic
1042704723 8:71653967-71653989 TGGGAAACTGAGGCACAGAGAGG + Intergenic
1042845771 8:73168300-73168322 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1044672770 8:94700047-94700069 TGAGGAAATGAAACCCAGAGAGG + Intronic
1046036068 8:108843156-108843178 AGGGGAACTGAGGCCTAGAGAGG + Intergenic
1046952241 8:120029886-120029908 TGCATAAGGGAGGCCCAGAGAGG + Intronic
1047511643 8:125520421-125520443 GGGGTAACTGAGGCCCAGAGAGG + Intergenic
1047743764 8:127828270-127828292 AGGGAAACTGAGGCCCAGAGTGG + Intergenic
1047774040 8:128054425-128054447 TGGAGAACTGAGGCTCAGAGAGG + Intergenic
1047927992 8:129699986-129700008 TGGAGCAATGAGGCTCAGAGAGG - Intergenic
1048008086 8:130435169-130435191 TGGGGAACTGAGGTCCACAGAGG + Intronic
1048114727 8:131508898-131508920 TAGGAAACTGAGGCCCAGAGAGG + Intergenic
1048282094 8:133113200-133113222 TGGGGAAGGCAGGCACAGAGAGG + Intronic
1048290971 8:133181521-133181543 TGGGGTTCTGAGGCCCAGAGGGG + Intergenic
1048344982 8:133569726-133569748 TGGGGAAGGGGCGCCCAGTGCGG - Intronic
1048860066 8:138717736-138717758 TGGGGAACACAGGGCCAGAGGGG + Intronic
1049203006 8:141350979-141351001 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1049207155 8:141368941-141368963 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1049253315 8:141600909-141600931 AAGGAATAGGAGGCCCAGAGAGG - Intergenic
1049255964 8:141614048-141614070 GATGGAAAGGAGGCCCAGAGAGG - Intergenic
1049258794 8:141627834-141627856 TGGGAAATTGAGGCCCAGAGAGG - Intergenic
1049261059 8:141639442-141639464 GGGGAAACTGAGGCCCAGAGAGG + Intergenic
1049273762 8:141709524-141709546 GGTAGAAATGAGGCCCAGAGCGG - Intergenic
1049313427 8:141946191-141946213 AGGGGAAAGGAGAGGCAGAGGGG + Intergenic
1049351576 8:142167453-142167475 TGGGGAAAGGAGTCCCCCACGGG - Intergenic
1049368012 8:142250046-142250068 AGGGCATGGGAGGCCCAGAGAGG - Intronic
1049653740 8:143788735-143788757 TGGGGACAGCAGCCCCACAGGGG + Intergenic
1050309258 9:4336053-4336075 TGGGAAATGGAGGCCCACAGAGG - Intronic
1050407478 9:5325160-5325182 TGGGGACAGGTGGCCGATAGGGG + Intergenic
1050712974 9:8486856-8486878 TGAGAAAATGAGGCCCAGAGAGG + Intronic
1050713532 9:8493293-8493315 TGGGAAATGGAGGCACAGATAGG - Intronic
1051686437 9:19663192-19663214 TAGGAAAAAGAGGCTCAGAGAGG + Intronic
1051732107 9:20154912-20154934 TGGGGCAAGTAAGGCCAGAGGGG + Intergenic
1052087557 9:24286510-24286532 AGGGGAAAGGAGGGGAAGAGAGG - Intergenic
1052390123 9:27869814-27869836 TGGGTAAAGGAGCAACAGAGAGG + Intergenic
1052691474 9:31821174-31821196 AGAGGAGAGGAGACCCAGAGTGG - Intergenic
1053451347 9:38196695-38196717 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1053690299 9:40583705-40583727 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
1054301550 9:63384666-63384688 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
1054866829 9:70011327-70011349 TGGAGAAATGAGGCCCAAAAAGG - Intergenic
1055691121 9:78831827-78831849 TGGGGAAGGGAGGTCCAGATTGG - Intergenic
1056308775 9:85319285-85319307 TGTGGGCAGCAGGCCCAGAGTGG - Intergenic
1056421196 9:86428021-86428043 TGGGCAAAGGAGGCCAGGTGCGG - Intergenic
1056461081 9:86810414-86810436 TGGGGTCAGGATGCCCAGGGTGG + Intergenic
1056513101 9:87324362-87324384 TTGGAAATGGAGGCACAGAGTGG - Intergenic
1056771671 9:89482021-89482043 AGGGGAAAGGAGGCAGGGAGAGG + Intronic
1056899164 9:90582635-90582657 TGCGGGAAGTAGGCCCGGAGTGG - Intergenic
1056940912 9:90955577-90955599 TGGGGAAAAGAAGTCCAGACAGG + Intergenic
1057010511 9:91597336-91597358 TGAGGAAAGCAAGCCCAGGGAGG - Intronic
1057082397 9:92182446-92182468 GGGGAAATTGAGGCCCAGAGAGG - Intergenic
1057245390 9:93451183-93451205 TGTGGGCAGCAGGCCCAGAGTGG + Intronic
1057280581 9:93708457-93708479 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1057706274 9:97397233-97397255 ATGAGAAATGAGGCCCAGAGTGG - Intergenic
1057872095 9:98725934-98725956 TGCGGAAAACAGGCTCAGAGAGG + Intergenic
1057880440 9:98788855-98788877 TGGGAAACTGAGGCCCAGAGAGG - Intronic
1057902210 9:98958190-98958212 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1057991455 9:99775066-99775088 TGGGCAGAGGAGGCCAAGACTGG - Intergenic
1058270610 9:102967722-102967744 AGTGGAGAGGAGACCCAGAGTGG + Intergenic
1058420503 9:104828745-104828767 GGGGAAAGTGAGGCCCAGAGAGG - Intronic
1058487073 9:105452385-105452407 AGGGAAAATGAAGCCCAGAGAGG + Intronic
1058545734 9:106059156-106059178 AGTGGAGAGGAGACCCAGAGTGG + Intergenic
1058545767 9:106059366-106059388 AGTGGAGAGGAGACCCAGAGTGG + Intergenic
1058923147 9:109637413-109637435 GGGGGCAAGGAGGCCGAGAGAGG + Intergenic
1059344818 9:113620939-113620961 TGGGAATCTGAGGCCCAGAGAGG + Intergenic
1059349765 9:113656449-113656471 TGGGGAAATAAAGCACAGAGAGG + Intergenic
1059366060 9:113787323-113787345 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1059410045 9:114126048-114126070 GAGGAAATGGAGGCCCAGAGAGG - Intergenic
1059415375 9:114158940-114158962 TGCGTAACTGAGGCCCAGAGAGG - Intronic
1059430216 9:114245544-114245566 GTGGAAAATGAGGCCCAGAGAGG - Intronic
1059443566 9:114324521-114324543 GAGGAAAATGAGGCCCAGAGAGG - Intronic
1059444757 9:114331296-114331318 GAGGAAAATGAGGCCCAGAGAGG - Intronic
1059640072 9:116207834-116207856 TGGGGAAATGAGACCCAGAGAGG + Intronic
1059909090 9:119022496-119022518 TGAGGAAATGAGCCCCAGAAAGG - Intergenic
1059994541 9:119896066-119896088 TGGGAAACTGAGGCCCAGAAAGG - Intergenic
1060022783 9:120146625-120146647 TGGATAACTGAGGCCCAGAGAGG - Intergenic
1060029737 9:120204041-120204063 TGGAGGACTGAGGCCCAGAGAGG - Intergenic
1060030685 9:120212464-120212486 TTGGGAAAGGAGGCCCCGTGTGG - Intergenic
1060199546 9:121644764-121644786 TAGGAAATGGAGGCACAGAGAGG + Intronic
1060204330 9:121673839-121673861 TGGGGAAACCAGGCCCTGAGAGG - Intronic
1060232179 9:121833602-121833624 TGAGGAACACAGGCCCAGAGAGG + Intronic
1060251733 9:121991854-121991876 GGGGAAACGGAGGCTCAGAGAGG + Intronic
1060344264 9:122802955-122802977 GGGGAAACTGAGGCCCAGAGTGG + Intronic
1060373978 9:123102262-123102284 TCAGGAAAGGAGGCTCAGATAGG - Intronic
1060413890 9:123417463-123417485 AGGAAACAGGAGGCCCAGAGAGG + Intronic
1060518391 9:124280002-124280024 AAGGGAATGGAGGCCCACAGAGG + Intronic
1060717357 9:125944886-125944908 TGAGAAAAGGAGGCACAGTGAGG - Intronic
1060736475 9:126069612-126069634 GGGGGAAGGGGGTCCCAGAGAGG + Intergenic
1060835788 9:126754431-126754453 TGAGGACACAAGGCCCAGAGAGG + Intergenic
1060896939 9:127224581-127224603 ATGGGAAAGGAGGGCCCGAGGGG + Intronic
1060940451 9:127540314-127540336 AGGGGAACTGAGGCTCAGAGAGG + Intronic
1060968230 9:127723416-127723438 GGGGAAACTGAGGCCCAGAGAGG - Intronic
1060993627 9:127862795-127862817 TGGCGGAGGGAGGGCCAGAGGGG - Intergenic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1061150885 9:128827335-128827357 TGGGAGACTGAGGCCCAGAGAGG - Intronic
1061164496 9:128914428-128914450 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1061211381 9:129195404-129195426 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1061296982 9:129682113-129682135 CAGGGAGAGGAGGTCCAGAGTGG + Intronic
1061298022 9:129687447-129687469 TGGGAAACTGAGGCACAGAGAGG + Intronic
1061434215 9:130550788-130550810 TGAGGAAATGAGGCACAAAGAGG + Intergenic
1061517713 9:131099067-131099089 TTGGAGAAGGAGGCTCAGAGAGG - Intronic
1061529155 9:131196588-131196610 GGGGGAATTGAGGCTCAGAGAGG + Intronic
1061665023 9:132155664-132155686 TGAGGAACTGAGGCCCAGAGAGG + Intergenic
1061730600 9:132611042-132611064 TGGGAACAGGAAGCACAGAGTGG + Intronic
1061780441 9:132992967-132992989 GGGGCAACTGAGGCCCAGAGAGG + Intergenic
1061806726 9:133141060-133141082 GGGGCAAGGGAGGCTCAGAGGGG + Intronic
1061938840 9:133873319-133873341 AGGGAAACCGAGGCCCAGAGAGG - Intronic
1061974397 9:134061112-134061134 TGGGGAGCAGAGACCCAGAGGGG + Intronic
1062031609 9:134364528-134364550 TGGGAAACTGAGGCCCAGACAGG + Intronic
1062152775 9:135030419-135030441 TGGGGACTGGAGGCAGAGAGGGG + Intergenic
1062316875 9:135971714-135971736 TGGGGTTAAGGGGCCCAGAGAGG + Intergenic
1062494392 9:136824990-136825012 AGGGGAAGGGAGAACCAGAGGGG - Intronic
1062517582 9:136944141-136944163 CCGGGAAGGGAGGCCGAGAGCGG + Intronic
1062566576 9:137166357-137166379 TGGGGAGGGGCTGCCCAGAGAGG + Intronic
1062665295 9:137667537-137667559 TGGGGAAAGCAGGACCCGGGAGG + Intronic
1203620996 Un_KI270749v1:129975-129997 TGAGAAAAGAAGGCGCAGAGAGG - Intergenic
1186238816 X:7544411-7544433 TGAGGAACAGAAGCCCAGAGAGG + Intergenic
1186365410 X:8887478-8887500 TAGGGAACTGAGGCACAGAGGGG - Intergenic
1186597376 X:10998080-10998102 TGGGGATAGGAGACAGAGAGGGG + Intergenic
1186659778 X:11657859-11657881 TGGGGATAGGAGGAGCAGGGAGG + Intronic
1187842775 X:23506054-23506076 TGAAGAAATGAGGCACAGAGAGG + Intergenic
1187910551 X:24107164-24107186 TGGGCAAAGGAGGCCATGCGTGG - Intergenic
1189188637 X:39075900-39075922 TTGGAAACTGAGGCCCAGAGGGG - Intergenic
1189262428 X:39688374-39688396 TTGGAAAATGAGGCACAGAGAGG - Intergenic
1189346723 X:40247559-40247581 GGGGAGAATGAGGCCCAGAGAGG - Intergenic
1189414512 X:40802593-40802615 AGAGGAGAGGAGGCCCAGATTGG + Intergenic
1190066536 X:47245292-47245314 TGGGGAGTGGGGGCCCAGCGGGG - Intronic
1190177972 X:48167174-48167196 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190180178 X:48185249-48185271 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190189870 X:48268272-48268294 TGGGGAAGGGAAGGGCAGAGGGG + Intronic
1190193193 X:48294472-48294494 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190199162 X:48345452-48345474 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190263988 X:48816651-48816673 TGGGGAGAGGAGGACCTGGGGGG + Intronic
1190658614 X:52634772-52634794 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190665930 X:52695920-52695942 TGGGGAAGGGAAGGGCAGAGGGG - Intronic
1190673488 X:52762490-52762512 TGGGGAAGGGAAGGGCAGAGGGG + Intronic
1190677033 X:52791261-52791283 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190756865 X:53408934-53408956 GGGGGAAATGAGGCTCGGAGAGG - Intronic
1192203273 X:69080776-69080798 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1192212138 X:69134400-69134422 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1192213948 X:69144942-69144964 CTGGAAAGGGAGGCCCAGAGAGG - Intergenic
1192799012 X:74448331-74448353 TGAGGAAACCAGGCTCAGAGGGG + Intronic
1194473526 X:94329347-94329369 TGAGGAACTGAGACCCAGAGAGG + Intergenic
1196016363 X:110944499-110944521 GGGAGGAAGGAGGACCAGAGGGG - Intronic
1196063948 X:111442119-111442141 AGGGGAAAGGAGACAGAGAGTGG + Intergenic
1196145402 X:112311310-112311332 TGGGGAAAGAGGTCCCAGAAAGG - Intergenic
1196306652 X:114111036-114111058 TGGTGGAAGCAGGCCCAGATAGG - Intergenic
1196633959 X:117978488-117978510 AGGGGAAAGGAAAGCCAGAGTGG + Intronic
1197042170 X:121950023-121950045 TGGTGAAAGCAGGAACAGAGAGG + Intergenic
1197705493 X:129631714-129631736 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1197722348 X:129753831-129753853 GGGGTAACTGAGGCCCAGAGAGG - Intronic
1197814271 X:130480515-130480537 TTGGGCAAGGGGGCTCAGAGGGG - Intergenic
1197946137 X:131841319-131841341 TGGGGAAAGGGTGGCCAGAGAGG - Intergenic
1198110940 X:133502166-133502188 GGGGAAATTGAGGCCCAGAGAGG - Intergenic
1198160208 X:134000478-134000500 TGGGGGGAGGAAGCCCAGGGAGG - Intergenic
1198184643 X:134241688-134241710 TAGGGGAAGGAGGCCCAATGGGG - Intronic
1198638863 X:138733605-138733627 AGGGGAACTGAGGCTCAGAGAGG - Intronic
1198663038 X:138991463-138991485 GGAGTAAATGAGGCCCAGAGAGG - Intronic
1199264093 X:145810274-145810296 GGGGAAAATGAGGCTCAGAGAGG - Intergenic
1199312287 X:146335182-146335204 GGGGAAACTGAGGCCCAGAGAGG - Intergenic
1199548288 X:149031239-149031261 TGGGGAAAGGAAGGCCATAATGG - Intergenic
1199700952 X:150375169-150375191 GGGGAAACTGAGGCCCAGAGAGG + Intronic
1199724866 X:150569558-150569580 GGGGGAACTGAGGCCCAGAGAGG + Intronic
1199769289 X:150963985-150964007 TGGGGAACTGAGTCCCAGGGAGG - Intergenic
1200019330 X:153188604-153188626 TGGAGGCAGGAGGCCCAGATGGG + Intergenic
1201901853 Y:19051697-19051719 TGTGGGAGGGAAGCCCAGAGAGG + Intergenic
1202379396 Y:24262409-24262431 TGGGGAAAGGAGGGTCCCAGGGG - Intergenic
1202491386 Y:25407712-25407734 TGGGGAAAGGAGGGTCCCAGGGG + Intergenic