ID: 1136020332

View in Genome Browser
Species Human (GRCh38)
Location 16:27436119-27436141
Sequence TCGCCCACACAGGTCGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136020329_1136020332 -2 Left 1136020329 16:27436098-27436120 CCAGCTTCAAAGACCACTCTCTC 0: 1
1: 1
2: 0
3: 23
4: 223
Right 1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 52
1136020328_1136020332 1 Left 1136020328 16:27436095-27436117 CCACCAGCTTCAAAGACCACTCT 0: 1
1: 1
2: 1
3: 20
4: 218
Right 1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 52
1136020326_1136020332 19 Left 1136020326 16:27436077-27436099 CCCGCAGGGTTGGTCTATCCACC 0: 2
1: 0
2: 0
3: 7
4: 64
Right 1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 52
1136020327_1136020332 18 Left 1136020327 16:27436078-27436100 CCGCAGGGTTGGTCTATCCACCA 0: 2
1: 0
2: 0
3: 4
4: 69
Right 1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136020332 Original CRISPR TCGCCCACACAGGTCGCCCA TGG Intronic
901237798 1:7676758-7676780 TGGCCCACAGAGGTGGCCCGTGG - Intronic
904367563 1:30024540-30024562 ACCCCCACCCAGGTCCCCCATGG + Intergenic
905584292 1:39105192-39105214 CTGCCCACACGGGTCCCCCAGGG - Intronic
907474285 1:54695312-54695334 TCCCCCCCACAGGTCCCCCTGGG + Intronic
914258511 1:145979578-145979600 TCGCCCACAGAGCTCTCCCTTGG + Intergenic
1068931160 10:62592091-62592113 TCTCCCACTTAGGTCCCCCAAGG - Intronic
1071901182 10:90121596-90121618 TCCCTCACACATGTCTCCCATGG + Intergenic
1075321446 10:121494494-121494516 TCTCCCACACAGGTAGGGCAGGG + Intronic
1080145965 11:28984273-28984295 TCCCCCACACAGGTTTCCCAGGG + Intergenic
1084351967 11:68608562-68608584 ACGCCCAGACAGGTCTGCCAGGG + Intronic
1085800565 11:79585547-79585569 TCTCCCACACTGGTCTTCCAGGG + Intergenic
1103639286 12:122336210-122336232 TCGCCAACAGAGGGCGCCTACGG + Intronic
1107153348 13:37138228-37138250 CGGCCCACCCAGGTAGCCCAGGG - Intergenic
1132514690 16:360668-360690 GCGTCCACACACGTCGCACACGG + Intergenic
1134021829 16:10926358-10926380 GCGCACACACAGGAGGCCCATGG - Exonic
1136020097 16:27434639-27434661 TCACCCACACAGGTCGGCCATGG + Intronic
1136020332 16:27436119-27436141 TCGCCCACACAGGTCGCCCATGG + Intronic
1142202069 16:88765915-88765937 CCGCCCACCCAGGCCTCCCAAGG + Intronic
1149634308 17:58154455-58154477 TTGCCCCCACAGATGGCCCATGG + Intergenic
1153675448 18:7452569-7452591 TCCTCCACACAGGGTGCCCAAGG + Intergenic
1157184074 18:45523265-45523287 TCACAAAGACAGGTCGCCCAGGG + Intronic
1160145187 18:76357845-76357867 TCACCCATACAGGACGCACAGGG - Intergenic
929001331 2:37349964-37349986 TCTCCCACACAGGCCACACAGGG - Intronic
933762072 2:85679323-85679345 TCGCAAACACAGGGCGGCCAGGG + Intergenic
937255969 2:120555781-120555803 TCTCCGACGCAGGTGGCCCAGGG + Intergenic
938341211 2:130537844-130537866 TCGCCTCCACAGCTCACCCAGGG + Intergenic
938348620 2:130582865-130582887 TCGCCTCCACAGCTCACCCAGGG - Intronic
943512378 2:188841312-188841334 TCTCCCAGTCAGGTGGCCCAGGG - Intergenic
948788129 2:240363633-240363655 TGGCCCACACAGCGCTCCCACGG + Intergenic
948855843 2:240730218-240730240 TCACCCACACAGGACCCACATGG + Intronic
1174560060 20:51424758-51424780 ACGTACACACAGGTCCCCCATGG - Intronic
1176265146 20:64205350-64205372 TCGCCCACATGGCACGCCCATGG - Intronic
1176300275 21:5095951-5095973 GCCCCCACACTGGTCACCCAGGG - Intergenic
1179856747 21:44165960-44165982 GCCCCCACACTGGTCACCCAGGG + Intergenic
1181629465 22:24143003-24143025 TGGACCACACAGCTGGCCCAGGG - Intronic
1181629653 22:24143893-24143915 TTGACCACACAGCTGGCCCAGGG - Intronic
1183736006 22:39645371-39645393 AGGCCCACCCGGGTCGCCCAGGG + Intronic
1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG + Intronic
950479593 3:13236264-13236286 GCCCCCTCACAGGTCCCCCAAGG + Intergenic
962974799 3:140436690-140436712 TTCCCCACACAGGTCTCCCTGGG - Intronic
968691451 4:1992351-1992373 TCCTCCACGCACGTCGCCCATGG - Intronic
971746382 4:30586691-30586713 TCACCCAGACAGGTGGCACAGGG + Intergenic
972328441 4:38040709-38040731 TTGCCCACAAAGGGCTCCCAGGG - Intronic
981128391 4:141132546-141132568 TCGCCCAAGCAGGACGCCCGCGG - Exonic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
998185341 5:139974969-139974991 TAGCCCACACAGGGGGCGCATGG - Intronic
1005311365 6:24562594-24562616 TCGCCCACTTAGGCCTCCCAGGG - Intronic
1006386460 6:33733714-33733736 AGGCCCACACAGGCAGCCCATGG + Intronic
1010000523 6:70944422-70944444 TATCCCACACATGGCGCCCACGG + Intronic
1010333074 6:74646943-74646965 TCACCCACACACTTCACCCAGGG + Intergenic
1016614392 6:146029380-146029402 TCGCCAACAATGGTCGTCCAAGG - Exonic
1040323439 8:46329642-46329664 TCTCTCACACAGGGCCCCCACGG - Intergenic
1058985725 9:110207328-110207350 TCTGCCACTCAGGTCTCCCATGG + Intronic
1061486083 9:130921129-130921151 TTGCCCACACAGGTCCCTCCGGG + Intronic
1062061873 9:134501393-134501415 TCGCGCACACAGGTTTCCCGAGG - Intergenic