ID: 1136021768

View in Genome Browser
Species Human (GRCh38)
Location 16:27445098-27445120
Sequence GGGTGGGCATGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136021768_1136021780 0 Left 1136021768 16:27445098-27445120 CCCATTTCCCACCATGCCCACCC 0: 1
1: 1
2: 4
3: 45
4: 452
Right 1136021780 16:27445121-27445143 CATATGGCCTCTGGTAGAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 100
1136021768_1136021774 -9 Left 1136021768 16:27445098-27445120 CCCATTTCCCACCATGCCCACCC 0: 1
1: 1
2: 4
3: 45
4: 452
Right 1136021774 16:27445112-27445134 TGCCCACCCCATATGGCCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136021768 Original CRISPR GGGTGGGCATGGTGGGAAAT GGG (reversed) Intronic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
901059416 1:6465277-6465299 GGGAGGGCAGGGTGGGAAGCAGG - Intronic
901335886 1:8448610-8448632 AGCTGGGCATGGTGGCTAATAGG + Intronic
902336690 1:15758526-15758548 GGGTGGGAATGGGGGGGAATGGG - Intronic
902542737 1:17166211-17166233 TGGTGGGCATGGTGGGTGGTGGG - Intergenic
902564969 1:17305489-17305511 GGGTGGGCATGGTGGAGATCAGG - Intergenic
902609179 1:17587367-17587389 AGGTGGGCATGGCTGGAACTGGG - Intronic
902788065 1:18745731-18745753 GAGTGGACATGCTGGGAACTTGG - Intronic
902826378 1:18977262-18977284 AGGTGTCCATGGTGGGAAAATGG - Intergenic
902956462 1:19927410-19927432 AGGGGGGCATGTTGGGAAAAGGG - Intergenic
904197157 1:28794456-28794478 GGGCAGCCATGGTGGGGAATGGG - Intergenic
904826336 1:33276139-33276161 GGCTGGGCATGGTGGGAGGAGGG - Exonic
905247245 1:36623733-36623755 TGGTGGGCAGGGTGGGTCATCGG + Intergenic
905278862 1:36836240-36836262 TGGTGGACATGGTGGGCACTGGG + Intronic
906129546 1:43447999-43448021 GGTGGGGCAGGCTGGGAAATGGG - Intronic
906203972 1:43977086-43977108 GCGTGGGCATCGTGGGCAGTGGG + Exonic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906748397 1:48237621-48237643 GGGTGGGCATGGTGTGGTGTGGG - Intronic
907598003 1:55737574-55737596 GGCTGGGCATGATGGGATGTGGG + Intergenic
908678530 1:66632953-66632975 GGGTGGGAATGCTGGGGAAGGGG + Intronic
910360198 1:86408489-86408511 TGCTAGGCATGGTGGGATATGGG + Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
912269328 1:108193046-108193068 GGTTGGGAATGTTGGGACATGGG + Intronic
912525216 1:110277849-110277871 GGCTGGGCATGGTGGCTCATAGG + Intronic
913528681 1:119716870-119716892 TGGTGAGCATGGAGGGAAACAGG - Intronic
915409878 1:155692360-155692382 AGGGGGGCATGTTGGGAAAAAGG - Intronic
915607665 1:156963318-156963340 GGATGAGCATGGTGGGAAGCCGG + Intronic
915732436 1:158063569-158063591 GGATGGGCAAGCTGGAAAATGGG - Intronic
916146038 1:161740160-161740182 GGGTGGGGAGGGTCGGAAGTTGG + Intergenic
916437569 1:164791081-164791103 GTGTGGGTAGGGTGGGAAAGAGG - Intronic
916473132 1:165143029-165143051 GAGTGGGGATGGTGGTAAAAGGG + Intergenic
920210663 1:204325988-204326010 GGCTGGGCAGGGTGAGGAATGGG - Intronic
920443388 1:205997128-205997150 GGGTTGGCATGGTGAGAAATGGG + Intronic
920744819 1:208616761-208616783 GGGTGGGCGTGGTGGGGAGGTGG + Intergenic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
922600306 1:226846274-226846296 GGCTGGGCATGGTGGCAGGTGGG + Intergenic
922667180 1:227480529-227480551 GAGTTGGCATAGTGGGAAAAAGG + Intergenic
922727289 1:227928336-227928358 GGGTGGGCAGGGTGGGCCGTTGG + Intronic
923438406 1:233992145-233992167 GGGTGGGATTGGTGGGCAAAGGG + Intronic
923640677 1:235756679-235756701 GGGTGGGCATCTTGTGTAATAGG - Intronic
924638902 1:245814793-245814815 GTGTGTGCATGGTGGGATAAGGG - Intronic
1064039008 10:11941685-11941707 GGGTGGGTTTGGTGGAGAATGGG - Intronic
1064115976 10:12577805-12577827 GGGTGGGGAAGGAGGAAAATGGG - Intronic
1067283270 10:44889066-44889088 GGATGGGCGTGGTGGGAGACAGG + Intergenic
1068746977 10:60543759-60543781 AGGTGGGCATTGTGAGAAAATGG - Intronic
1068950029 10:62767524-62767546 GGTGGGGCTTGGGGGGAAATAGG - Intergenic
1069726810 10:70585526-70585548 AGGTGGGCAAGGTTGGAAATGGG - Intergenic
1069781985 10:70962690-70962712 GGGTGGGCTTGGGTAGAAATTGG - Intergenic
1070815808 10:79322541-79322563 GGCTGGGGATGGTGGCAGATGGG - Intergenic
1071319545 10:84439932-84439954 GGTAGGGAATGGTGGGAAATAGG + Intronic
1071687750 10:87779034-87779056 GGCTGGGCATGGTGGCACTTTGG + Intronic
1072713609 10:97734849-97734871 GGGTGGACAGGGTGGGGGATGGG + Intergenic
1072755149 10:98015338-98015360 GGCTGGGTATAGGGGGAAATGGG + Intronic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1072944529 10:99798011-99798033 GGGTGCGCATGGGGTGAGATGGG + Intronic
1073191148 10:101651320-101651342 GGGTGGAGAGGGTGGGAAATGGG + Intronic
1073234778 10:102004788-102004810 GGCTGGGCATGGTGGCTCATGGG + Intronic
1074103700 10:110373773-110373795 AGGTGGGTCTTGTGGGAAATAGG - Intergenic
1074376725 10:112946929-112946951 GGCTCTGCATGTTGGGAAATGGG - Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075292783 10:121244562-121244584 TGGTGGTGGTGGTGGGAAATGGG - Intergenic
1076251758 10:128990136-128990158 GGTTGTGCATGGTGGTAAATTGG + Intergenic
1076263932 10:129094237-129094259 GAGTAGTCATGGTGAGAAATAGG + Intergenic
1076599557 10:131648004-131648026 GGATGGGCCTGAAGGGAAATGGG - Intergenic
1076688529 10:132208994-132209016 GGGTGGGCGTGGTGGCAGAGAGG - Intronic
1077273126 11:1691084-1691106 GGGTGGGCCTGGTAGGTACTGGG + Intergenic
1077540823 11:3145743-3145765 GGGAGGCCCTGGTGGGAAGTGGG + Intronic
1077598747 11:3557607-3557629 TGGTGGTCGTGGTGGGAAACTGG - Intergenic
1077660386 11:4063107-4063129 GGGTGGGGGCAGTGGGAAATAGG + Intronic
1078142093 11:8700067-8700089 GGGGGGGCAGGGTGGCAAAGAGG + Intronic
1078391175 11:10936810-10936832 TGGTGGGCAGGTTGGGAAAGGGG + Intergenic
1078556318 11:12329467-12329489 GAGGTGGCATGGTGGGAAGTGGG + Intronic
1078924455 11:15861380-15861402 GTGTGGGCATGGAGTGCAATGGG - Intergenic
1078970900 11:16410006-16410028 GGGTGGGGATGGGGAGGAATAGG + Intronic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1080668878 11:34358224-34358246 GGGTGGGGATGGGGGGGGATGGG + Intergenic
1082028039 11:47586946-47586968 GCGTGGGCATGGTGGGTACCAGG + Intronic
1083222513 11:61262296-61262318 AGGAGGGCACGGTGGGAAAGAGG + Intronic
1083735386 11:64677340-64677362 GGGAGGGGATGGTGGGGAAGAGG - Intronic
1084177648 11:67431743-67431765 GGATGGGCATGGTGCGAATTTGG + Intronic
1084331391 11:68432658-68432680 AGGAGGGGATGCTGGGAAATCGG - Intronic
1085524873 11:77158253-77158275 TGGTGGGCAGGGTGGGAGAGTGG - Intronic
1088821844 11:113463354-113463376 GGTTTGGCATGGTAGGAAGTGGG + Intronic
1089128360 11:116193150-116193172 GGGTGGGGAAGGTGGAAAAGTGG + Intergenic
1089176642 11:116553313-116553335 GGGAGGGAGTGGTGGGATATTGG - Intergenic
1089760697 11:120720866-120720888 GGGTGAGGATGGAGGGAAAAGGG + Intronic
1090095658 11:123740298-123740320 GGGTGGGCAGGGTTGGAGAGAGG - Intronic
1090339501 11:126004044-126004066 GGGTTGGCATGCTGGGAAGCTGG - Exonic
1090763351 11:129856028-129856050 GGGCGGGCATGGGGGGAAAAGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091437119 12:481497-481519 GGCTGGCCATGGTGGGAAAGTGG + Intronic
1091787707 12:3252878-3252900 GGGTGCAGAAGGTGGGAAATGGG + Intronic
1091951484 12:4596550-4596572 TGGCCGGCAGGGTGGGAAATGGG - Intronic
1093766973 12:22975230-22975252 GGGAGGGCAGGGTGGGTAAGGGG - Intergenic
1093838657 12:23868690-23868712 GGGTGGGAATGAAGGGATATGGG - Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095178469 12:39120068-39120090 GGGTGGGGATGTTGTGAAAAGGG - Intergenic
1096188171 12:49597460-49597482 GGGTGGGGGTGGGAGGAAATGGG + Intronic
1096557428 12:52411977-52411999 GGAAGGGCGTCGTGGGAAATGGG - Intergenic
1096741558 12:53697343-53697365 GGCTGGGGATGGGGGGAGATGGG + Intergenic
1096777707 12:53974132-53974154 GGGTGGGGAGGGAGGGAAAAGGG + Intronic
1097087894 12:56482276-56482298 GTGTGGGCATGATGGGGAATAGG - Intronic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098534534 12:71579769-71579791 GGGTGGACTTGGGGGGAAGTGGG - Intronic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1099319927 12:81133368-81133390 GTAGGGGCATGGTGGGCAATTGG - Intronic
1099438076 12:82667233-82667255 GGATGGGAATGGTTGGAAAGAGG + Intergenic
1100011775 12:89962084-89962106 GGGTGGGATGGGGGGGAAATGGG + Intergenic
1102400805 12:112628091-112628113 GGGGGGGCCTGGTGGGTGATTGG - Intronic
1102908101 12:116692975-116692997 GGAAGGGCAAGGTGGGGAATTGG - Intergenic
1103641098 12:122353102-122353124 GGGAGGGCAAGGTGGGAGAATGG + Intronic
1103801545 12:123541122-123541144 GGGAGGCCAAGGTGGGAAAATGG - Intergenic
1103948772 12:124540795-124540817 GGGTGGATATGGAGGGGAATGGG + Intronic
1104229594 12:126871667-126871689 GGCTGGGCATGGTGGCACTTTGG + Intergenic
1104756639 12:131273684-131273706 GGGTGGGCATGGTGTGATGTGGG - Intergenic
1104932906 12:132349303-132349325 GGATGGGAATTGTGGGAAATTGG - Intergenic
1104953975 12:132454858-132454880 GGGTGGGCAGGGTGAGGAAGTGG + Intergenic
1104996869 12:132663587-132663609 GAGGGGCTATGGTGGGAAATGGG + Intronic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1107007510 13:35630936-35630958 AGGGGGGAATGGTGGGAAGTGGG - Intronic
1107854071 13:44597515-44597537 GGGTGGGCAGGGTGGGCCATGGG + Intergenic
1108755894 13:53501964-53501986 GGGTGGGCATGGGGTGAGAAAGG - Intergenic
1110287866 13:73771016-73771038 AAGTGGGGATGGTGGGAGATAGG - Intronic
1111500291 13:89109965-89109987 GGGTGGGGAGGTTGGGATATTGG + Intergenic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1113271510 13:108679865-108679887 AGGTGGGCTGGGTGTGAAATGGG - Intronic
1113619262 13:111701844-111701866 GGGTGGGCCTGCTGGGAGCTGGG - Intergenic
1113624791 13:111787105-111787127 GGGTGGGCCTGCTGGGAGCTGGG - Intergenic
1113946992 13:114049970-114049992 AGGTGGGCATGGCAGGACATGGG + Intronic
1114492650 14:23113069-23113091 GGGGGGGCGTGGTGAGCAATAGG + Intergenic
1114633208 14:24172683-24172705 GGGTGGGGAAGGTGGGAGAATGG - Intronic
1115268111 14:31522594-31522616 GGGTGGGGATGGTGGGAGACAGG - Intronic
1117824632 14:59688463-59688485 GGGTGGGACAGGTGGCAAATGGG - Intronic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118615010 14:67569255-67569277 AGGTGGGCAGGGTGGGCAAGCGG + Intronic
1118726506 14:68632735-68632757 GGGTGGGCATGGTGGGCCAACGG - Intronic
1119444789 14:74654145-74654167 GGCTTGGCATGGTGGGAAGAAGG - Intronic
1119783733 14:77297043-77297065 TGGTGGGAATGGTGGGAACTCGG + Intronic
1120665628 14:87303289-87303311 GGTTGGGAAAGGTGGGAAATAGG + Intergenic
1122019017 14:98820987-98821009 GGTTGGGCATGGTGCTAGATAGG + Intergenic
1122363878 14:101183131-101183153 GGGTAGGCAGGGAGGGAAAGAGG - Intergenic
1122452102 14:101817687-101817709 GGGTGGGCGGGGTGGGGGATGGG - Intronic
1122718319 14:103708182-103708204 GGGTGGGAACGGTGTGAGATGGG - Intronic
1122728398 14:103776496-103776518 GGCTGGGCATGGTGAGATACTGG - Intronic
1122755506 14:103976031-103976053 GGCTGGGAAGGGGGGGAAATAGG - Intronic
1123393374 15:19899750-19899772 GCGGGTGCGTGGTGGGAAATGGG + Intergenic
1123432713 15:20232172-20232194 GGGTGGACCTGGAGGGGAATAGG - Intergenic
1124214894 15:27798030-27798052 GGGTGTGCAGGGTGGGCAAGAGG + Intronic
1124713271 15:32031939-32031961 GGGAGAGCATGATGGGAAAGAGG + Intronic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1125409717 15:39393169-39393191 GTGTGGACATTGTTGGAAATTGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1128213294 15:65916946-65916968 GGGTGGGCAAGCTGGGATGTCGG + Exonic
1128637735 15:69313910-69313932 GGATGGGCAGGGTGGGGAGTGGG + Intronic
1128767882 15:70262156-70262178 GGGTGGGCAAGGAGAGAGATGGG - Intergenic
1129542001 15:76357927-76357949 GGGAGGGAAAGGTGGGAAAGTGG + Intronic
1130539124 15:84809268-84809290 GGGAGGTGATGGTGGGAAAAGGG + Intergenic
1131650166 15:94389315-94389337 GGGTGGGCATGGAGGGGAAGTGG + Intronic
1133314259 16:4872465-4872487 GGGTGGGCATGGTGGGGGGGCGG + Intronic
1133998818 16:10766966-10766988 GGGAGGGGTTGGTGGGAGATGGG - Exonic
1134073782 16:11276540-11276562 GGCTGGGCAGGGTGGGGACTGGG - Intronic
1134288619 16:12884247-12884269 GGGTGGGAAGGGTGGGAAGGGGG + Intergenic
1134869954 16:17643501-17643523 GGGTGGGGACTGTGGAAAATTGG - Intergenic
1134915024 16:18062196-18062218 AGGTGGGATTGGTAGGAAATAGG + Intergenic
1135036544 16:19082949-19082971 GGGCGGGGATGGGGAGAAATAGG + Intergenic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1135048481 16:19173363-19173385 AGGTGGGCAGGGTGGGGAAGAGG - Intronic
1135107742 16:19665309-19665331 GGTGGGGCATGGTGGGGAGTGGG - Intronic
1135243783 16:20836063-20836085 GGGTGGGTGTGGGGGTAAATGGG - Intronic
1136001269 16:27295798-27295820 GGGTTGGGATGTTGAGAAATTGG - Intergenic
1136021768 16:27445098-27445120 GGGTGGGCATGGTGGGAAATGGG - Intronic
1136043638 16:27599394-27599416 GGGTGGGGAAGGTGGGAATGAGG + Intronic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1136851918 16:33618941-33618963 GGGTGGACCTGGAGGGGAATAGG + Intergenic
1136902283 16:34051558-34051580 GCGGGTGCATGGTGGGAACTGGG + Intergenic
1136957762 16:34804308-34804330 GTGGGTGCATGGTGGGAACTGGG + Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1137662022 16:50215957-50215979 CGTTGGCCAGGGTGGGAAATAGG + Intronic
1137726786 16:50662055-50662077 GGGTGGGCAGGGTGGCACAGTGG + Intergenic
1138139429 16:54555285-54555307 GGATGGGAATGCTGGGACATAGG - Intergenic
1138415902 16:56871177-56871199 GGGTGGGCATGGTGGCTCAGGGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1139235820 16:65337714-65337736 GGGTGAGCATGTGGGAAAATTGG + Intergenic
1139456734 16:67085498-67085520 GGGTGGGGGTGGGGGGAGATGGG + Intronic
1139477280 16:67208973-67208995 GGGTGGACAGGGTGGGCCATGGG + Intronic
1140055448 16:71521715-71521737 GGATGGGGAGGGTGGGAAATGGG - Intronic
1140114675 16:72031224-72031246 GGCTGGCCATGGTGGGACCTGGG - Intergenic
1141530008 16:84639754-84639776 TGCAGGGAATGGTGGGAAATGGG - Intergenic
1141933532 16:87220833-87220855 GGCTGGGCATGGTGGCTCATGGG + Intronic
1142141953 16:88476445-88476467 GGGCGGCCATCGTGGGAACTGGG + Intronic
1142234733 16:88916642-88916664 GGGTGGGCTGGGTGGGGAAGGGG + Intronic
1142341052 16:89522849-89522871 AGGAGGGCATGGTGGGGAAAAGG - Intronic
1142495794 17:305679-305701 GTGTGGGCGTGGTGGGAGAGTGG - Intronic
1142903835 17:3029437-3029459 GGGTGGGCTTGGGGGGATCTGGG + Intronic
1143133220 17:4694215-4694237 GGGAGGGCTTGGTGGGCAATGGG + Intronic
1144255106 17:13459945-13459967 GAGTGAGCATGGTGGGACAGAGG - Intergenic
1144743160 17:17595671-17595693 GGGTAGCCAGGGTGGGAACTGGG + Intergenic
1145760089 17:27420837-27420859 GGGTGGTCAGGGTGTAAAATGGG - Intergenic
1146397363 17:32479470-32479492 GGGTGTGCCTGGTGGGCAAGAGG + Intronic
1146453220 17:32991047-32991069 GGGTGTGCATGGATGGAAGTGGG - Intronic
1146564110 17:33897066-33897088 GGGTAGGCACATTGGGAAATAGG + Intronic
1146941180 17:36845472-36845494 GGGTGGGGGGAGTGGGAAATGGG + Intergenic
1147381352 17:40058105-40058127 GGGAGGGAATGATGGGAAAGAGG + Intronic
1147592695 17:41695028-41695050 GGGAGGCCAAGGTGGGAAAATGG + Intergenic
1147661585 17:42119868-42119890 GGGTGGGCATGGTGGTAGGGAGG - Intronic
1149406261 17:56354673-56354695 GGGTGGGGATTGTGAGAGATTGG - Intronic
1149634858 17:58158430-58158452 GGGTGGGCGTGGGGAGAGATAGG - Intergenic
1150002730 17:61451839-61451861 TGGTGGGCATGGTAGGGAAGCGG + Intergenic
1150352615 17:64457756-64457778 AGGTGGCCATGGTGGGAAATGGG - Intronic
1150604685 17:66680792-66680814 GGGTGGGGGAGGTGGGAAAGGGG + Intronic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1151162432 17:72176612-72176634 GGGTTGGCACGGGGGGAAAATGG + Intergenic
1151320572 17:73350026-73350048 GATTGGGCATGGTGGGGACTGGG + Intronic
1152637938 17:81437827-81437849 GCCTGGCCATGGTGGGAACTCGG + Intronic
1152932488 17:83116956-83116978 GGCTGAGCCTGGTGGGGAATGGG + Intergenic
1155377668 18:25178560-25178582 GGTGGGAAATGGTGGGAAATAGG - Intronic
1158595711 18:58814144-58814166 TGGTGAGGATGTTGGGAAATTGG + Intergenic
1158964421 18:62610836-62610858 GGGTGGTGATGGTGGGATTTGGG + Intergenic
1159589488 18:70317902-70317924 GGGTGTGCATGGTGTGATCTTGG + Intronic
1159890480 18:73948594-73948616 GTCTGGGCTTGTTGGGAAATGGG + Intergenic
1160686456 19:439068-439090 GGGTGGCCATGGAGGGAGCTGGG + Intronic
1161857058 19:6772175-6772197 GGGAGGGCAGGGAGGGAACTGGG + Intergenic
1162215961 19:9134188-9134210 GGCTGGGCATGGTGGCGAAACGG - Intergenic
1162468607 19:10858443-10858465 TGGTGGGCATGCTGCGTAATAGG + Intronic
1162796266 19:13089179-13089201 AGGTGGGCAGGGTGGGGGATGGG + Intronic
1163251226 19:16127525-16127547 AGGTGGGCATGGTGGCACAAGGG + Exonic
1163441477 19:17324395-17324417 GGGTGGGCTGGTTGGGAAACAGG + Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163549409 19:17957224-17957246 GGGAGGGGATGGTGGGGAAGGGG + Intronic
1164819457 19:31235342-31235364 GGTTGGGGTTGGGGGGAAATGGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165407909 19:35642095-35642117 GGGGGTGCATGGTATGAAATGGG + Exonic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166537660 19:43585142-43585164 GGCTGAGCATGGTGGCATATGGG - Exonic
1166871149 19:45872092-45872114 GGGGGGCCATGGTGGGCACTGGG - Exonic
1167322547 19:48805840-48805862 GGGGAGGCATGGTGGGAGAGGGG - Intronic
1168086240 19:54049330-54049352 GGAAGGGCCTGGTGGGAAAGTGG + Intronic
1168277840 19:55286927-55286949 GGGTGGCCAAGGGGGGACATAGG + Intronic
925368417 2:3326446-3326468 AGGTGGGCATGGTGGGAGCAGGG - Intronic
926220509 2:10932825-10932847 GGGTGCGCATGCTGGGATCTGGG + Intergenic
926231878 2:11010470-11010492 TGGTGGGCAGGGTGGGGAAAAGG + Intergenic
928090055 2:28368405-28368427 GGGTGCCCATGGTGGAAAATGGG - Intergenic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
928777502 2:34783343-34783365 GGGTGGGCATTATGAGAAAATGG - Intergenic
929885325 2:45872839-45872861 GGGTGGGCATGGAGGGGCAGCGG + Intronic
930045923 2:47172812-47172834 GGGGGGGGGGGGTGGGAAATGGG + Intronic
930846319 2:55908434-55908456 GGGTGAGAATGGGGGGAGATGGG + Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931217692 2:60261881-60261903 GGGTTGGAAGGGTGGGAAAGGGG - Intergenic
932958421 2:76383446-76383468 GTGTGTCCTTGGTGGGAAATGGG + Intergenic
933707550 2:85303302-85303324 GGTTGGGCATGGTGGCACACCGG - Intronic
934063702 2:88320393-88320415 GGTGGGGGATGGTGGGAAATGGG - Intergenic
935529182 2:104211916-104211938 AGGTGAGCATGCTGGGGAATGGG - Intergenic
935689921 2:105721798-105721820 GGGTGGTCATGGTAGGGAGTGGG - Intergenic
936461080 2:112714132-112714154 GGGTGGGCATGCTGGGACCAGGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936584399 2:113741271-113741293 GGCTGGGGGTGGTGGGAAAGAGG + Intronic
936674856 2:114702992-114703014 GGGTGAGCAGGGTGGGAAGAAGG + Intronic
936855547 2:116953342-116953364 GGAGGGGCCTGGTGGGAGATTGG - Intergenic
937131372 2:119516564-119516586 GGGTGGGAATGGAGAGATATAGG + Intronic
937150661 2:119683506-119683528 GGGTGGGAGTGGTGAGAAAGTGG - Intronic
937779734 2:125823222-125823244 GTGAGGGCCTAGTGGGAAATGGG + Intergenic
937954328 2:127412020-127412042 GGTTGGGCATGGTGGAAGAAGGG - Intergenic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
937988490 2:127649414-127649436 GGGTGGGGATGGTGGATACTGGG + Intronic
938518100 2:132037571-132037593 GCGGGTGCATGGTGGGAACTGGG - Intergenic
938556799 2:132431778-132431800 TGGTGGGGATGATGGCAAATGGG + Intronic
938721260 2:134069181-134069203 GTGTGGGACTGGTTGGAAATTGG - Intergenic
940009326 2:149038254-149038276 GGGTGGGCAAGGTGGGGACGGGG + Intronic
940790182 2:158023644-158023666 GGGTGGACACGGTGGGAGTTGGG + Intronic
941670269 2:168285368-168285390 TGGTGGGACTGGTAGGAAATAGG + Intergenic
941956231 2:171207600-171207622 GGTTGGGCATGTTTGGAGATGGG + Intronic
943662608 2:190575189-190575211 TGTTGGGGATGGTGGGAAACTGG - Intergenic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946493426 2:220171906-220171928 TGGTGGGGATGGTGGTAAACTGG + Intergenic
948144910 2:235701395-235701417 GGGTGGGCATGGTGGCATCTTGG + Intronic
948570388 2:238913838-238913860 GGGTGGGCAGGGTGGGTCCTGGG + Intergenic
948658745 2:239493475-239493497 GGTGGGGCCTGGTGGGATATGGG - Intergenic
948990557 2:241551853-241551875 GGGTGGGCAGGGCAGGAAGTGGG - Intergenic
1170905904 20:20515053-20515075 GGGTGGGCAGGGGGCAAAATGGG - Intronic
1171400195 20:24868257-24868279 GCGTGGGCAGGCTGGCAAATAGG - Intergenic
1171771450 20:29325750-29325772 AGGTATGCATGGTGGGAAAGAGG + Intergenic
1171813606 20:29764011-29764033 GTGTGGGCATTGTGAGAAAAAGG - Intergenic
1172050128 20:32110638-32110660 GTGTGGCCATGTTGGGGAATGGG - Intronic
1172649787 20:36494732-36494754 GGGAGGGCAAGGAGGGAAGTAGG - Intronic
1172831329 20:37837712-37837734 AGGTGGGCATGGGGGCAAACAGG - Intronic
1172904068 20:38355791-38355813 GCGTGGGCCAGGTGGGAACTGGG + Intronic
1173756546 20:45521729-45521751 GGGTGGGGAGGGAGGGAAAGAGG - Intergenic
1174053612 20:47784181-47784203 GGGTGGACCCGGTGGGAAACAGG + Intronic
1174407896 20:50313893-50313915 GGGTGGTCAAGGTGGGAGAAGGG + Intergenic
1174545200 20:51319785-51319807 GGGTGGCCTCAGTGGGAAATGGG + Intergenic
1176740657 21:10598840-10598862 GGGAGGGCATGGCAGGGAATAGG - Intronic
1176978691 21:15354107-15354129 GGGGGGGCAGGGTGGAAAGTGGG - Intergenic
1177447023 21:21210871-21210893 GAGTTGGGAGGGTGGGAAATGGG + Intronic
1178961220 21:37067545-37067567 GGGTTGGGATGGTGGGATAGAGG - Intronic
1179217631 21:39380920-39380942 GGGTGGGTAGGGTGGGAGACAGG + Intronic
1179638338 21:42729569-42729591 GGGTGCTCATGGTGGGATCTTGG + Intronic
1179889004 21:44326467-44326489 GGGTGGGCATGGGGGCACAGCGG + Intronic
1180105660 21:45616653-45616675 GGGAGGGGCTGGTGGGAAACCGG - Intergenic
1180843152 22:18968544-18968566 GGATGGGCATGGGGGGAAATGGG - Intergenic
1181058318 22:20270190-20270212 GGATGGGCATGGGGTGAAATGGG + Intronic
1181362855 22:22352254-22352276 GGGTGGGCATCATGAAAAATGGG - Intergenic
1181514858 22:23404643-23404665 GGATGGGCATGGGAGGAAATGGG + Intergenic
1183475297 22:38032853-38032875 GGGTGGCCACGGTGGGAGGTGGG + Intronic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1183616174 22:38947079-38947101 GGTTGGGGATGATGGGAAATGGG - Intergenic
1184011284 22:41750554-41750576 GTGTGGGGAAGGTGAGAAATGGG + Intronic
1184193726 22:42912344-42912366 GTGTGTGCATGGTGGGTGATGGG + Intronic
1184599751 22:45536260-45536282 GGCTGGGCAGGGTGGGGGATGGG + Intronic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
949919188 3:8987997-8988019 GGGTGGGGATGGTGGTAGAGGGG - Intronic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
952089493 3:29867244-29867266 GGGTGGGAATGGGGGAGAATGGG + Intronic
955412703 3:58666486-58666508 AGGTGGGGAGGGTGGGAAATAGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955951049 3:64242415-64242437 GGGTAGACAGGGTGGGAAAGAGG - Intronic
956059901 3:65338935-65338957 GAGTGGTCATGGTGGTAGATTGG - Intergenic
956606576 3:71078990-71079012 GAGTGGGCGTGGTAGGAAGTGGG - Intronic
956791138 3:72680919-72680941 AGGTGGACATCGTGGGAAGTGGG - Intergenic
956978561 3:74610776-74610798 GGGTGAACATGGAGGGAAGTGGG + Intergenic
957792893 3:84961470-84961492 GGGTGTGAAAGGTGAGAAATGGG - Intronic
957823639 3:85411970-85411992 AGCTGGGCATGGTGGCATATGGG - Intronic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
959525212 3:107368809-107368831 GGTGGGGCATGGTGTGAACTGGG - Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
960330657 3:116356443-116356465 GGGAGTGGGTGGTGGGAAATGGG + Intronic
961524949 3:127490780-127490802 GGGTGGGCATGGTGGGGGTAGGG - Intergenic
961975545 3:131020959-131020981 GGGTGCGTATGGTGTGAAATAGG - Intronic
962902717 3:139775179-139775201 GGGTGGGCAAGATGGGAATGAGG + Intergenic
962915177 3:139894716-139894738 GGTTGGGTATGGTGGGAGACAGG + Intergenic
963071415 3:141308424-141308446 GGGTGGGGATGCTGGGGTATGGG - Intergenic
964683543 3:159368711-159368733 TAGTGGGCATGGTGAGAGATAGG + Intronic
965519099 3:169655197-169655219 TGGCGGGGATGGTGGGAAACTGG - Intronic
965826265 3:172734032-172734054 GGGAGGCCAAGGTGGGAATTGGG - Intergenic
966600808 3:181773386-181773408 TGGTGAGAATGGTGGGAGATGGG + Intergenic
968356915 3:198115654-198115676 GGAAGGGCAGTGTGGGAAATGGG + Intergenic
968474735 4:798534-798556 AGCTGGGCATGGTGGCACATGGG - Intronic
968819263 4:2837464-2837486 GGGTGGGCATTGGGGGAGAGGGG + Exonic
969209620 4:5676877-5676899 GGGTGGGGATGGTGGGTGACAGG + Intronic
969706368 4:8794324-8794346 GGGTGGGAATGGAGGGACAGAGG + Intergenic
971049389 4:22843926-22843948 GGATGGGGTTTGTGGGAAATGGG + Intergenic
971287195 4:25302170-25302192 GGGTGGGATTGGGGGGTAATGGG - Intergenic
971464931 4:26947467-26947489 GGGTGGGGAGTGGGGGAAATTGG + Intronic
972358455 4:38304062-38304084 GGGTGGAGAGGGAGGGAAATGGG + Intergenic
972378199 4:38493748-38493770 GGGTGGGTTGGGTGGGACATAGG - Intergenic
972723432 4:41723964-41723986 GGGTGAGGATGGAAGGAAATGGG - Intergenic
973173896 4:47179680-47179702 AGATAGGCATGGTGGTAAATAGG + Intronic
978326303 4:107561039-107561061 GGGTGCCCATGGTGGGAGAGAGG - Intergenic
981826651 4:148950129-148950151 GGGAGGGCATGGGGGGAAGGGGG - Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984481755 4:180312454-180312476 GAGTGAACATGATGGGAAATAGG - Intergenic
984789479 4:183602206-183602228 AGCTGGGCATGGTGGCAACTTGG + Intergenic
985549368 5:525195-525217 GGGTGGGCTTGGAGGAAAACAGG - Intergenic
985938042 5:3111666-3111688 GGGCGGGCATTGTTGGAAGTGGG + Intergenic
986106800 5:4667494-4667516 AGGTGGGTAGGGTGGGAAAGGGG + Intergenic
986251483 5:6062186-6062208 AGGTGGGCATGGAAGGAAAGGGG - Intergenic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
989343983 5:40408559-40408581 TGATGGGGATGGTGGGAAAGGGG - Intergenic
990362581 5:55035679-55035701 GGAGGAGCATGGTGGGAGATTGG + Intergenic
992252606 5:74890223-74890245 GGGTGGGGATGGGGGTAGATGGG + Intergenic
992895215 5:81239695-81239717 GGGAGGGCATGGTTGGCTATGGG - Intronic
993767568 5:91879851-91879873 GGGTGGGGGGTGTGGGAAATGGG - Intergenic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
995639993 5:114244594-114244616 GGGCGGGCATGGGGGGTTATTGG + Intergenic
995735180 5:115293176-115293198 GGGAGGGCAAGGAAGGAAATAGG + Intronic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
997457725 5:134029749-134029771 GGTTAGGGATGGTGGGAAAAGGG + Intergenic
997689739 5:135819585-135819607 GGATGGGAATGGAGGGAAAATGG + Intergenic
998002128 5:138633692-138633714 GGATGGGGATGGTGGGAATGGGG - Intronic
998076566 5:139241509-139241531 GGGTGTGCAGGGTGGGGAATGGG - Intronic
999259191 5:150227727-150227749 GGGTGGGCAGTTTGGGAAAGAGG - Intronic
999713164 5:154336676-154336698 GGGTGGGACTGGAGGGGAATTGG - Intronic
1000843214 5:166247656-166247678 GGATGGACATGGTGGGAAACAGG - Intergenic
1002527743 5:179824230-179824252 GGGTGGCCAGGATGGGAAATGGG + Exonic
1002670409 5:180861596-180861618 GTGGGGGCCTGGCGGGAAATGGG + Intergenic
1004572720 6:16863398-16863420 GGGTGGTCAAGATGGGAAGTAGG + Intergenic
1004872601 6:19922457-19922479 GGCTGGGCTTGCTGGGAAACAGG + Intergenic
1006170286 6:32088163-32088185 TGGTGGGCTTGGAGGGGAATGGG - Intronic
1006339250 6:33437634-33437656 GGGTGGGCATGATGTTAAAGGGG - Intronic
1006523812 6:34587598-34587620 GGGTGGCCATGGTGGGAAATGGG - Exonic
1006671001 6:35729579-35729601 GGAGGGTCATGGTGGGCAATGGG - Intergenic
1006805638 6:36787328-36787350 GGGTGGTGATGGTGGGAGTTGGG - Intronic
1007210410 6:40189347-40189369 GGGTGGGCAGGGTGGGTGGTGGG + Intergenic
1008282979 6:49618285-49618307 GGATGTGCCTGGTGGGAGATGGG - Intronic
1008447658 6:51611464-51611486 GAGTGGGCATGGTGTGTAAGTGG + Intergenic
1009047089 6:58245903-58245925 GGGTGTACACGGTGGGATATTGG - Intergenic
1009937849 6:70254678-70254700 GGGGGAGTAGGGTGGGAAATAGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1014752194 6:125268692-125268714 GGGTGGGCTTCCTGGGATATTGG - Intronic
1015514964 6:134074254-134074276 GGGTGAGCATCCTGGGAAACCGG + Intergenic
1016351785 6:143176696-143176718 GGGGTGGCATGGTGGGAGGTGGG - Intronic
1018037379 6:159893158-159893180 GGGTGACCATGGTGGAAAGTAGG - Intergenic
1018214031 6:161509455-161509477 AGGTGGGCATGGTGGCAGATTGG + Intronic
1018264514 6:162008296-162008318 GGTGGAGAATGGTGGGAAATGGG - Intronic
1019125933 6:169840133-169840155 GGGTGGGCGTGGTGTGGAGTGGG - Intergenic
1019125955 6:169840214-169840236 GGGTGGGCGTGGTGTGGAGTGGG - Intergenic
1019125977 6:169840300-169840322 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019125981 6:169840316-169840338 GAGTGGGCATGGTGTGGAGTGGG - Intergenic
1019126003 6:169840403-169840425 GGGTGGGCATGGCGTGGAGTGGG - Intergenic
1019126024 6:169840489-169840511 GGGTGGGCATAGTGTGGAGTGGG - Intergenic
1019496631 7:1343659-1343681 GGGTGGGCATGGCGGGGACCAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020430128 7:8110124-8110146 TAGTAGTCATGGTGGGAAATGGG - Intergenic
1026405677 7:70063089-70063111 GGGTGGGGATGTTGGGAAAGGGG - Intronic
1026762994 7:73140474-73140496 GGCTGGGAATGGTGGCAGATGGG + Intergenic
1027039459 7:74950262-74950284 GGCTGGGAATGGTGGCAGATGGG + Intergenic
1027044237 7:74981089-74981111 GGGTGGGCTGGGTGGGAAGGGGG - Intronic
1027084182 7:75252118-75252140 GGCTGGGAATGGTGGCAGATGGG - Intergenic
1027810120 7:82885671-82885693 GGGTAGGGATGAAGGGAAATGGG + Intronic
1028505703 7:91568035-91568057 GGGTGAGATTGGTGGGAAGTGGG + Intergenic
1028710596 7:93903238-93903260 GGGTGGGGATGTTTGGCAATAGG + Intronic
1030538026 7:110793066-110793088 GGGTGGGCAGTTGGGGAAATGGG + Intronic
1030699521 7:112622628-112622650 GGGAGGGCTTTGTGGGAACTGGG - Intergenic
1031697623 7:124878018-124878040 GGGTGGCAGTGGTGAGAAATGGG + Intronic
1031798537 7:126211173-126211195 TGGTGAGCATGCTGAGAAATTGG + Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032824652 7:135557293-135557315 GGGCTGCCGTGGTGGGAAATTGG + Intergenic
1034543720 7:151776498-151776520 TGGTGGACATGGTGGGACGTTGG - Intronic
1035259884 7:157654271-157654293 CGGCGGGCATGGTGTGGAATTGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1035605820 8:929222-929244 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1035605871 8:929384-929406 GAGTGGGAATGGCGGGGAATCGG - Intergenic
1037631114 8:20657195-20657217 GGGAGGGCAAGGTGGGAGATGGG - Intergenic
1037754936 8:21704510-21704532 AGGTGGGCATGGATGGCAATGGG + Intronic
1038411259 8:27361559-27361581 GACTGGGCAGGGTGGGAAAATGG + Intronic
1038645808 8:29361269-29361291 GGGTGGGGAAGGTGGGGGATTGG - Intergenic
1039595188 8:38785409-38785431 GGATGGGCATAGAGGGGAATGGG + Intronic
1039988366 8:42467045-42467067 GGGAGGCCATGGTGGGAAAATGG - Intronic
1039990227 8:42481492-42481514 GGGTGGGCAGGGAGAGACATGGG + Intronic
1040311982 8:46241478-46241500 GGGTGGGGTGGGTGGGACATAGG + Intergenic
1040454185 8:47579706-47579728 GGGTGGGGATGGTGGGGTAGAGG - Intronic
1041090961 8:54300301-54300323 GGGTGGGGATGGGGGGAAACCGG + Intergenic
1041370204 8:57151387-57151409 GGCTGGGCCTGGGGGAAAATAGG - Intergenic
1041599876 8:59704328-59704350 GGATGGGGGTGGTGGGGAATGGG + Intergenic
1043053301 8:75407785-75407807 GGGTGGGGATGGGGGGACTTGGG - Intergenic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1043951245 8:86311520-86311542 TGGGGGGCATGGTGGGCTATAGG - Intronic
1044676545 8:94734305-94734327 GGCTGGGCATGGTGGCACTTTGG - Intronic
1044942065 8:97353662-97353684 GGGAGGGCTTTGTGGAAAATAGG - Intergenic
1045555789 8:103213419-103213441 GGGTTGGCAGGGTGGGGAGTGGG + Intronic
1045913597 8:107439928-107439950 GTCTGGACATGGTGGGTAATTGG + Intronic
1047545366 8:125811362-125811384 GGGTGTGCAGAGTGGGAAGTGGG + Intergenic
1048081188 8:131129340-131129362 GGGTGGCCAAGGTGGGAGAATGG - Intergenic
1048201763 8:132380585-132380607 GGGTGTGAAGGGTGGGAGATGGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048609191 8:136003426-136003448 GGGTGGGAATGGTGTGAAAATGG + Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1048891352 8:138951578-138951600 GGGTGGGGATGGTGGGTCGTGGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050340147 9:4628705-4628727 GGCTGGGCATGGTGGCACTTTGG - Intronic
1050530888 9:6588506-6588528 GGGTGGCCATGCTGGGAGAATGG - Intronic
1051363329 9:16301646-16301668 GGCTGGGGGTGGTGGGAAAGGGG + Intergenic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1052014253 9:23446676-23446698 AGGTGGGGGCGGTGGGAAATTGG + Intergenic
1052880195 9:33597167-33597189 GGGTGGGTAGTGTGGGAAGTAGG + Intergenic
1053495777 9:38547051-38547073 GGGTGGGTAGGGTGGGAAGTAGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1056006675 9:82279234-82279256 GGGTGCGTGTTGTGGGAAATGGG + Intergenic
1056949229 9:91028796-91028818 TGATGGGGATGGTGGGCAATAGG - Intergenic
1057043324 9:91863737-91863759 GGCTGGGCCTGGGGGGAGATAGG + Intronic
1057397020 9:94689508-94689530 GGGTGGGCAAGGTGGACAATTGG - Intergenic
1057675711 9:97134566-97134588 GGGTGGGTAGGGTGGGAAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1058216541 9:102240878-102240900 AGGTGGCCATGGTGGGACCTGGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058790140 9:108436272-108436294 GGGTGTTGAGGGTGGGAAATTGG - Intergenic
1058956301 9:109951826-109951848 GGGAGGACATGTTGGGAGATTGG - Intronic
1059065105 9:111075484-111075506 GTGTGTGTATGGTGGGAATTAGG - Intergenic
1059677171 9:116550550-116550572 GTGTGGGCAAGGTGGGGATTGGG + Intronic
1060033558 9:120235804-120235826 GGTTGGGCAAAGTGGGAAGTGGG - Intergenic
1060597014 9:124854430-124854452 GGCTGGGCAGGTTGGGAGATGGG + Intronic
1061423320 9:130483938-130483960 GGGTGGGCACGTTGGGCAAGTGG - Intronic
1062199521 9:135294517-135294539 GGGTGGGCTTGGGGTGGAATTGG - Intergenic
1062212714 9:135373233-135373255 GGGTGGGGCTGGCGGGCAATGGG + Intergenic
1185602379 X:1349150-1349172 AGGTGGGCATGGTGGTACATGGG - Intronic
1185859044 X:3560871-3560893 AGGGGGACATGATGGGAAATGGG - Intergenic
1185929849 X:4190089-4190111 GGGTGGGCAGGGTTGGAAATGGG + Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189415311 X:40807525-40807547 GGCTGGGAATGGTGGGAGAAAGG - Intergenic
1189907359 X:45775138-45775160 GAGTGGGCAGGGTGGGAGAAAGG + Intergenic
1191700105 X:64033230-64033252 GGGTGGGCATGGTGCAGAAGTGG - Intergenic
1192139841 X:68638223-68638245 GCGTGGGCAAGGTGGGGACTTGG - Intergenic
1192961461 X:76135735-76135757 GGGTGGAGAAGGTGGGAACTGGG - Intergenic
1192991845 X:76467696-76467718 GGGGAGGCATGGTGTGAGATTGG - Intergenic
1194208606 X:91040613-91040635 GGGCTGGCAAGATGGGAAATAGG - Intergenic
1194634478 X:96327611-96327633 GGGTAGGGATGGAGGGGAATTGG - Intergenic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195722488 X:107879557-107879579 TGGTGGGCAGGGTGGGCCATGGG + Intronic
1196097295 X:111814246-111814268 GGGAGGGCATTGAGGGATATGGG - Intronic
1196192029 X:112804892-112804914 GGGTGGGAGGGCTGGGAAATCGG - Intronic
1197091081 X:122538511-122538533 TTGTGGGCATTGTGGGATATGGG + Intergenic
1197304993 X:124830788-124830810 AGGTGGGAATGGTGGTAGATAGG - Intronic
1198373195 X:136011749-136011771 GGGTGGGGACGGTAGGAAAGAGG + Intronic
1199146040 X:144368196-144368218 GGGTGTACATGGAGGGAATTGGG + Intergenic
1199673257 X:150163984-150164006 TGGTGGGCATGGAGGCAGATTGG + Intergenic
1201065110 Y:10089468-10089490 GAGTGGGCATTGTGAGAAAAAGG - Intergenic
1201346891 Y:12994416-12994438 GGGGGGGCATGTTGGGAAAAAGG - Intergenic