ID: 1136023791

View in Genome Browser
Species Human (GRCh38)
Location 16:27456903-27456925
Sequence CCCTGGAAGGCGGTGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136023781_1136023791 -6 Left 1136023781 16:27456886-27456908 CCCAAAACAAATCCCATCCCTGG No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023772_1136023791 21 Left 1136023772 16:27456859-27456881 CCAGCACAATGCTGGCTCCCCCC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023779_1136023791 -2 Left 1136023779 16:27456882-27456904 CCACCCCAAAACAAATCCCATCC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023777_1136023791 0 Left 1136023777 16:27456880-27456902 CCCCACCCCAAAACAAATCCCAT No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023780_1136023791 -5 Left 1136023780 16:27456885-27456907 CCCCAAAACAAATCCCATCCCTG No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023773_1136023791 4 Left 1136023773 16:27456876-27456898 CCCCCCCCACCCCAAAACAAATC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023776_1136023791 1 Left 1136023776 16:27456879-27456901 CCCCCACCCCAAAACAAATCCCA No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023774_1136023791 3 Left 1136023774 16:27456877-27456899 CCCCCCCACCCCAAAACAAATCC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023771_1136023791 22 Left 1136023771 16:27456858-27456880 CCCAGCACAATGCTGGCTCCCCC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023783_1136023791 -7 Left 1136023783 16:27456887-27456909 CCAAAACAAATCCCATCCCTGGA No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023775_1136023791 2 Left 1136023775 16:27456878-27456900 CCCCCCACCCCAAAACAAATCCC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data
1136023778_1136023791 -1 Left 1136023778 16:27456881-27456903 CCCACCCCAAAACAAATCCCATC No data
Right 1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136023791 Original CRISPR CCCTGGAAGGCGGTGTGATG GGG Intergenic
No off target data available for this crispr