ID: 1136025547

View in Genome Browser
Species Human (GRCh38)
Location 16:27465953-27465975
Sequence TAGGGTGTGTAGAAGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136025547_1136025553 -2 Left 1136025547 16:27465953-27465975 CCAGGCCCCTTCTACACACCCTA 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1136025553 16:27465974-27465996 TACTTTTGCCTACACTAGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 97
1136025547_1136025554 -1 Left 1136025547 16:27465953-27465975 CCAGGCCCCTTCTACACACCCTA 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1136025554 16:27465975-27465997 ACTTTTGCCTACACTAGCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1136025547_1136025555 3 Left 1136025547 16:27465953-27465975 CCAGGCCCCTTCTACACACCCTA 0: 1
1: 0
2: 0
3: 15
4: 228
Right 1136025555 16:27465979-27466001 TTGCCTACACTAGCCAGGGCTGG 0: 1
1: 0
2: 3
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136025547 Original CRISPR TAGGGTGTGTAGAAGGGGCC TGG (reversed) Intronic
900155230 1:1201204-1201226 CCGGGTGCGGAGAAGGGGCCGGG - Intergenic
900368709 1:2322067-2322089 GCGGGTGTGGGGAAGGGGCCAGG - Intronic
901168663 1:7237910-7237932 TAGGATGTGTGTAAGGTGCCCGG - Intronic
901603956 1:10444576-10444598 TATGGTGAGGAGAAGGGGCAAGG + Intronic
901679812 1:10906418-10906440 TGGGGTGGGAGGAAGGGGCCTGG + Intergenic
902410904 1:16210990-16211012 GAGGGTGGGAAGAAGGGGACTGG + Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
905314888 1:37076085-37076107 TAGGGTGTGAAGAAGCTGGCTGG + Intergenic
905630950 1:39518350-39518372 GGGGGTGTGGAAAAGGGGCCAGG + Intronic
905666810 1:39767826-39767848 GGGGGTGTGGAAAAGGGGCCAGG - Intronic
908013235 1:59804723-59804745 TATGGTGTGTAAAAGGGTGCTGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
914255611 1:145959753-145959775 CAGGGTGTGAATAAGGAGCCAGG + Exonic
915031430 1:152883337-152883359 TAGAGGGTCTAGAAGTGGCCAGG - Intronic
915802151 1:158805535-158805557 TAGGGTGTGTGTTAGGGGCAAGG + Intergenic
915954727 1:160212364-160212386 TAGGGTGTTTAGAAATGGCTGGG + Intronic
916059585 1:161089453-161089475 CTGGGTGTGTAGAACGGGGCCGG - Exonic
916502358 1:165397752-165397774 TAGGGTGTGGAGAAGGAGTTAGG + Intergenic
916746082 1:167685870-167685892 TAAGGTGTGGAGAAGGTACCTGG + Intronic
919982487 1:202650969-202650991 CAGAGTGGGAAGAAGGGGCCGGG + Intronic
920366454 1:205450585-205450607 GAGGGTGGGTGGAGGGGGCCAGG - Intronic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1063776410 10:9270287-9270309 TATGGTGTGTAGATGGAGCAGGG + Intergenic
1064789381 10:18938647-18938669 TAGGAAGAGTAGAAGGGGCTGGG + Intergenic
1067103833 10:43351652-43351674 TGGGGGGTGTGGAGGGGGCCTGG - Intergenic
1067830670 10:49609732-49609754 GAGTGTGTGTGCAAGGGGCCAGG + Intronic
1068886033 10:62098014-62098036 TAGAGAGCGTAGCAGGGGCCAGG + Intergenic
1070488251 10:76951421-76951443 TAGGGTGTGTTTAAGTGACCAGG - Intronic
1071536902 10:86440936-86440958 TGGGGTGGGTAGATGGGCCCAGG + Intronic
1071885757 10:89949021-89949043 TAGGAAGGGTAGTAGGGGCCTGG + Intergenic
1072721032 10:97781270-97781292 GAGGGTGTGGAGAAGCGGCATGG + Intergenic
1073061957 10:100738477-100738499 GAGGGTGTGTAAAAAGTGCCAGG - Intronic
1073179231 10:101574014-101574036 TGGGGAGGGTAGGAGGGGCCTGG - Intronic
1073665012 10:105521730-105521752 TAATCTGTGTGGAAGGGGCCAGG - Intergenic
1077106699 11:845368-845390 TGGGGCCTGTAGATGGGGCCGGG + Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078085838 11:8232615-8232637 TAGGGGCTGTAGCGGGGGCCTGG - Intronic
1083206448 11:61152497-61152519 TGGGGGGTGTAGAAGAGGGCTGG - Intronic
1083459583 11:62801923-62801945 AAGGGTGTGTTTAAAGGGCCTGG - Exonic
1083886835 11:65577149-65577171 TAGGGTGTGACGCAGGGGCCTGG - Intronic
1083894133 11:65611703-65611725 GAGGGTGGGGAGCAGGGGCCTGG + Intronic
1084054573 11:66624321-66624343 AAGGGTCAGAAGAAGGGGCCTGG + Exonic
1085145839 11:74196427-74196449 TATGGTGTGAGGAAGGGGTCTGG + Intronic
1088280961 11:108134347-108134369 TAAAATGTGTAAAAGGGGCCGGG + Intronic
1091383279 12:76702-76724 AAGGCTGTGTGGAAGGGGACAGG + Intronic
1094414444 12:30202063-30202085 TGGTGTGTGTGGAAGGGGCGGGG + Intergenic
1095091023 12:38105353-38105375 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1097055262 12:56245313-56245335 GAGTGTGTGTAGAGGGGGACAGG - Intronic
1099681652 12:85836915-85836937 GAGAGTGTGGAGCAGGGGCCTGG - Intergenic
1101881704 12:108630224-108630246 TATGGGGTCTAGATGGGGCCTGG - Intronic
1103045838 12:117733829-117733851 CAGGGTCTGTATAAGAGGCCTGG - Intronic
1103511545 12:121478234-121478256 AATGGTGTGTCGAAGGGGACTGG + Intronic
1104939950 12:132390361-132390383 TCGGGTGTGCGGATGGGGCCTGG + Intergenic
1106372536 13:29149697-29149719 TATAGTGTAAAGAAGGGGCCTGG + Intronic
1106512206 13:30421822-30421844 GAGGGGGTGGAGAAGGGACCGGG + Intergenic
1112257016 13:97843562-97843584 AAGAGTGGGTTGAAGGGGCCAGG + Intergenic
1113925668 13:113940195-113940217 AAGAGTGTGCAGCAGGGGCCTGG + Intergenic
1114629288 14:24148846-24148868 GAGGGTGTGGTGAGGGGGCCAGG - Exonic
1116002030 14:39254113-39254135 GAGGGTGGGGAGAAGGAGCCTGG + Intronic
1117959742 14:61151055-61151077 TAAGGAGTGTAGAAAGGGTCAGG + Intergenic
1120098904 14:80421669-80421691 TGGGGAGTTTAGAAGGAGCCAGG + Intergenic
1120215868 14:81680014-81680036 TGTTTTGTGTAGAAGGGGCCAGG + Intergenic
1121256702 14:92535910-92535932 TAAGTTGTGAAGAAGGGACCAGG + Intronic
1121303958 14:92893719-92893741 TTGGTTGTTTAGAAGAGGCCCGG + Intergenic
1122051777 14:99065731-99065753 TAGGGGGTGAAGAAGAGGTCAGG - Intergenic
1122076931 14:99242024-99242046 AAGGGTGGGTAGAAGGGGACAGG + Intronic
1122175923 14:99918925-99918947 TCCGGTGTGTAGGAGGTGCCAGG - Intronic
1124637051 15:31371953-31371975 GAGGGTGTGAAGGCGGGGCCAGG + Intronic
1126385706 15:48091207-48091229 TAGGGTGTGAAGCTGGGGACGGG - Intergenic
1126468520 15:48982739-48982761 ATGTGTGAGTAGAAGGGGCCAGG + Intergenic
1127854215 15:62941493-62941515 CAGGCTGTGTGGACGGGGCCAGG - Intergenic
1128086711 15:64891703-64891725 TGGGATGGGTAGAAGGGGCAGGG + Intronic
1128291089 15:66478978-66479000 CAGGGTGGGTAGAAGAGGACAGG + Intronic
1128581350 15:68812357-68812379 AAGAGTGTGGAGAAGGGGCTGGG + Intronic
1128692169 15:69733042-69733064 AAGGGTGTGGAGAAGGGGACAGG - Intergenic
1130010481 15:80149523-80149545 TAGGGTGGGGAGAAGGGGATTGG - Intergenic
1130310566 15:82750339-82750361 TAGGGAGTGGAGAAAGGGCCGGG - Intergenic
1130414893 15:83683727-83683749 GAGGGTGTGAAGGAGGCGCCGGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133483517 16:6195420-6195442 TTAGGTTTGTAGAATGGGCCGGG + Intronic
1135718503 16:24794082-24794104 TAGGCTGTGTACAAGATGCCCGG + Intronic
1136025547 16:27465953-27465975 TAGGGTGTGTAGAAGGGGCCTGG - Intronic
1136374444 16:29857018-29857040 TAGGGTTTGGTGAAGGGGCTGGG - Intergenic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1141432804 16:83979597-83979619 TGGGGTGCTTTGAAGGGGCCAGG + Intronic
1141496653 16:84414917-84414939 CAGGATGGGTTGAAGGGGCCAGG + Intronic
1142036340 16:87864385-87864407 CAGGGTGTGAAGGAGAGGCCGGG - Intronic
1142142089 16:88477010-88477032 GATGGTGTGGAGAAGGGACCCGG - Intronic
1142595391 17:1027288-1027310 TAGGGAGGGTAGAAGGGCGCTGG - Intronic
1146279908 17:31538245-31538267 GAGGGTGGGCAGAAGAGGCCTGG + Intergenic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1148337121 17:46849446-46849468 TAGGGGGTGTGGCTGGGGCCTGG + Intronic
1150790141 17:68196549-68196571 TAGGGGGTGGGGAAGGGGACAGG + Intergenic
1150874813 17:68959105-68959127 TATGATATTTAGAAGGGGCCAGG + Intergenic
1151461297 17:74255793-74255815 TGGGGTGGGCAGAAGGGTCCTGG + Intronic
1151833391 17:76568933-76568955 AAGGGGGTGTAGAAGGTGGCAGG + Intronic
1152405806 17:80097141-80097163 TGGAGTGTGTGGAAGGTGCCTGG + Intronic
1152863556 17:82709491-82709513 TAGGGTGTGCAGAGAGGGACCGG - Intergenic
1153890088 18:9505357-9505379 TAGGGTGTGGAGAAGAGGCAGGG - Intronic
1154223197 18:12475322-12475344 TAGGGTATGTAGAATGTGACTGG - Intronic
1154340124 18:13495966-13495988 TACAGGGTTTAGAAGGGGCCTGG - Intronic
1158190858 18:54827296-54827318 TAATGTGTGTAGAACGTGCCTGG - Intronic
1160483596 18:79265915-79265937 TATGGTGTAAAGAAGGGGTCCGG + Intronic
1160914009 19:1488152-1488174 CAGGGTGGGTAGACGGGGACGGG - Intronic
1161091144 19:2360560-2360582 TGGGGTGTGTAGACATGGCCAGG + Intergenic
1161091147 19:2360579-2360601 CAGGTTGTGTAGATGCGGCCAGG + Intergenic
1161398922 19:4059139-4059161 TGGGGTGGGTAGGAGGGCCCGGG - Intronic
1162968526 19:14166915-14166937 TGGGGAGAGAAGAAGGGGCCGGG + Intronic
1163555404 19:17989496-17989518 CATGGTGCATAGAAGGGGCCTGG + Intronic
1164901464 19:31929545-31929567 TAGGGTGTGGAGAACAGGCCTGG - Intergenic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165708603 19:37993712-37993734 AAGTGTGTGAAGGAGGGGCCAGG + Intronic
1166980912 19:46631598-46631620 TAGGGTGTGGAGGAGGAGCGGGG - Intergenic
1168714280 19:58518069-58518091 CCCGGTGTGTAGAAGAGGCCAGG + Intronic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
925709580 2:6725897-6725919 AATGGAGTGAAGAAGGGGCCAGG + Intergenic
925739391 2:6992489-6992511 TAGGGTGTGGAGAACGGGTAAGG + Intronic
926211536 2:10874421-10874443 CAGGGTTTGTAGAAGGTGCAAGG - Intergenic
926801933 2:16666305-16666327 TAGGGTGGGCAGAAAGGGACTGG - Intronic
926809362 2:16742634-16742656 TAGGGTGGGTGGATGGGGCAGGG + Intergenic
928115572 2:28543265-28543287 GATGGTGAGTAGATGGGGCCTGG + Exonic
931796741 2:65718139-65718161 TGGGGTGTGAAGAAGCAGCCAGG - Intergenic
932706767 2:74032131-74032153 TCAGGTGTGTCAAAGGGGCCAGG - Intronic
935581772 2:104761805-104761827 TAGGGGGTGTAGTAGGTACCTGG + Intergenic
938806757 2:134813385-134813407 GTGGGTGTGTAGATGGAGCCTGG - Intergenic
943273148 2:185833339-185833361 AAGGAAGTGTAGAAGGGACCAGG + Intergenic
944107735 2:196097469-196097491 GAGTGTGTGTAGGTGGGGCCAGG - Intergenic
947078558 2:226370202-226370224 TGGTGTGTGTTGAAGGGGCAGGG - Intergenic
948117672 2:235505654-235505676 AAGGCTGTGTGGGAGGGGCCTGG + Intronic
948706090 2:239793317-239793339 TACCGTGGGGAGAAGGGGCCAGG - Intronic
1169169554 20:3453579-3453601 TAGGGTGAGTAAAAGGGATCTGG + Intergenic
1172461540 20:35122781-35122803 TAGGAGGTGTAGAGGGGACCAGG - Intronic
1172905261 20:38364341-38364363 TAGGGAGTGTAGATGGGCCTAGG + Intronic
1174292566 20:49519490-49519512 AAGGGTGAGGAGGAGGGGCCAGG - Intronic
1175186840 20:57184470-57184492 GAGGGTGTGTTCAAGGGGCAGGG + Intronic
1175462310 20:59160602-59160624 TGGGGTCTGGAGAAGGGCCCAGG + Intergenic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1176281900 20:64318085-64318107 AAGGCTGTGTGGAAGGGGACAGG - Intergenic
1179626239 21:42651087-42651109 GAGGGTGCATGGAAGGGGCCAGG - Intergenic
1180609394 22:17085594-17085616 GGGGCTGTGGAGAAGGGGCCCGG + Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180815702 22:18787924-18787946 CAGGGTGTGTATGCGGGGCCAGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181201890 22:21222259-21222281 CAGGGTGTGTATGCGGGGCCAGG - Intronic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181549335 22:23628011-23628033 CAGGGTGGGTAGAGGGGCCCTGG - Intronic
1181633101 22:24161710-24161732 GAGGGTGTGGAGAATGTGCCAGG - Intronic
1181699859 22:24614709-24614731 CAGGGTGTGTATGCGGGGCCAGG + Intronic
1183219946 22:36506208-36506230 TAGCGTGTGAAGAAGCTGCCGGG + Exonic
1183354307 22:37350223-37350245 CAGTTTGTCTAGAAGGGGCCAGG + Intergenic
1183592314 22:38786936-38786958 TAGGGTGTGTGGGAGGGACTGGG + Intronic
1183738075 22:39654822-39654844 AAGGATGTGTACAAGGGGCAGGG + Intronic
1184251183 22:43261236-43261258 TCTGGTGTGGAGACGGGGCCTGG + Intronic
1184407143 22:44306678-44306700 TGGTGTGTGTGGAAGGGACCTGG + Intronic
1184479897 22:44740281-44740303 TAGGGTCAGCAGATGGGGCCAGG - Intronic
1184693032 22:46125968-46125990 TCGGCTGTGTAGAATGGGGCAGG - Intergenic
1185040291 22:48500548-48500570 AAGGGGGTGTGGAAGGCGCCGGG + Intronic
1203225021 22_KI270731v1_random:73169-73191 CAGGGTGTGTATGCGGGGCCAGG + Intergenic
1203265807 22_KI270734v1_random:13615-13637 CAGGGTGTGTATGCGGGGCCAGG - Intergenic
950581351 3:13864330-13864352 TAGGGAGGGTAGAAGAGGCTGGG - Intronic
953927198 3:46988509-46988531 GAGGGTGTGGAGAAGGGGAGTGG - Intronic
955113289 3:55971602-55971624 TGGGGTATGAAGAAGGGGGCTGG + Intronic
959807733 3:110577559-110577581 TACTGTGAGTGGAAGGGGCCAGG - Intergenic
963474549 3:145788712-145788734 TAGGGTGTGTAGGAGGCACAGGG + Intergenic
964402065 3:156310315-156310337 TAGGGTGTGGAGGAAGGGTCAGG + Intronic
965218570 3:165897004-165897026 TAGGGTGTTTAGAAAGGTTCTGG + Intergenic
968480615 4:831511-831533 CAGGGTGGGTGGACGGGGCCAGG - Intergenic
969593693 4:8136265-8136287 AAGGGTGGGTGGCAGGGGCCGGG + Intronic
969704345 4:8783909-8783931 TATGGTGAGTAACAGGGGCCTGG - Intergenic
970512062 4:16790959-16790981 AAGGGTGTGAAGAAAGGGCCTGG - Intronic
970695905 4:18676714-18676736 TAAGGTGTGTGGGAGGGGGCAGG + Intergenic
972437654 4:39049386-39049408 TTGAATGTGTATAAGGGGCCAGG + Intronic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
985654833 5:1125089-1125111 TGTGGTGTGGAGTAGGGGCCGGG - Intergenic
985700085 5:1365963-1365985 TAGGGGGTGGATAAGGGGGCGGG + Intergenic
992951730 5:81865022-81865044 TGGGGTGTGTAGCAGGGGTTGGG - Intergenic
996772002 5:127095818-127095840 CAGGGTGAGTAGTAGGGACCGGG + Intergenic
999082158 5:148854963-148854985 TAGAGTGTGAGGAAGGGGCCTGG + Intergenic
1001299949 5:170526265-170526287 TTGAGTGTGTAGTAGGAGCCAGG - Intronic
1001428227 5:171638893-171638915 GAGGGTGTATGTAAGGGGCCAGG + Intergenic
1002007496 5:176247784-176247806 TAAGGTGTAAGGAAGGGGCCCGG + Intronic
1002776897 6:336066-336088 TTGGCTGTATAGAAGGGACCTGG + Intronic
1002860430 6:1075011-1075033 GAGGGTTTGCAGAAGAGGCCTGG - Intergenic
1003222005 6:4169084-4169106 CAGAGTGTGTAGGAGGGGCAAGG + Intergenic
1004110290 6:12711234-12711256 TTGGGTGTGTACGAGGAGCCAGG + Intergenic
1005411960 6:25558784-25558806 TAGGGTGAGGAGCAGGGCCCTGG + Intronic
1006187397 6:32189208-32189230 TAGGGTGTGTGAAGGGGTCCTGG + Intronic
1006644016 6:35503902-35503924 TTGGCTGTGTGGAAGGGGCCTGG - Intronic
1006840415 6:37025088-37025110 GAGGCTGGGTAAAAGGGGCCTGG - Intronic
1010198082 6:73259685-73259707 AAAAGTGTGGAGAAGGGGCCAGG - Intronic
1013590102 6:111612592-111612614 TTCTATGTGTAGAAGGGGCCAGG - Intergenic
1014230436 6:118896235-118896257 TTGGGTGTGAAAAATGGGCCTGG - Intronic
1016238019 6:141891169-141891191 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1017290143 6:152726549-152726571 TTCGGTGTGTAGAACTGGCCAGG + Intergenic
1018764874 6:166925373-166925395 TAGGCAGTGTAGATGAGGCCTGG - Intronic
1019175055 6:170155315-170155337 TGGGTTCTGTAGAAGGGTCCTGG - Intergenic
1019290920 7:249820-249842 CAGGCTGTGCAGCAGGGGCCTGG - Intronic
1026433622 7:70373177-70373199 GAGGGTCTGTGGGAGGGGCCAGG + Intronic
1026681185 7:72467653-72467675 TAGGGTGTGTTGCTGGGGCGGGG - Intergenic
1027318185 7:76997138-76997160 TAGGGTGTGTAGAAGTGTGTGGG + Intergenic
1029569898 7:101362663-101362685 TAAGGTGTGTAGCGGGGGCCTGG + Intergenic
1029648663 7:101875108-101875130 GAGGGTGTGTACAAGGCCCCAGG - Intronic
1033158710 7:138978882-138978904 TAGGGTGTGTGTAGGGTGCCTGG - Intronic
1034878461 7:154745733-154745755 CAGGGTGTTTAGGAGGTGCCAGG + Intronic
1035092870 7:156329183-156329205 GAGGGTGTGGAGAAGGGTCTGGG - Intergenic
1035778902 8:2211585-2211607 CAGGTTGTGTAGAAGGTGCCTGG - Intergenic
1037707882 8:21331026-21331048 TAGGGTGTGTTAAAGGGTGCAGG - Intergenic
1039084410 8:33765711-33765733 TATGGTGTGAGGTAGGGGCCAGG - Intergenic
1039120334 8:34138832-34138854 TTGGGTGAGTAAAAGGGGCACGG + Intergenic
1040832246 8:51690311-51690333 TAGGGTGTGGGGAAGGGGGAGGG - Intronic
1041845897 8:62328858-62328880 AAGGGTGTGTAGCAGGAGACAGG - Intronic
1042298810 8:67252704-67252726 TAGAGTGTCTAGAAGGGGGCTGG + Intronic
1043836255 8:85050367-85050389 TAGGGTGTCTATAAGTTGCCTGG - Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1047420598 8:124704908-124704930 CAGGGTGTGAAGCAGGGTCCCGG - Intronic
1047749307 8:127867724-127867746 TGGGGTGGGGAGAAGGGGACTGG + Intergenic
1049197673 8:141324550-141324572 TGGGGTGTGGTGGAGGGGCCTGG + Intergenic
1049401568 8:142429938-142429960 GAGGCAGTGTAGGAGGGGCCTGG - Intergenic
1049428169 8:142546680-142546702 TTGGGTGTGAACATGGGGCCAGG - Intergenic
1049804752 8:144533809-144533831 GAGGATGTGGGGAAGGGGCCAGG + Intronic
1053216215 9:36272773-36272795 AAGAATGTGGAGAAGGGGCCGGG + Intronic
1053366032 9:37523207-37523229 TTGGGTGTATAGTAGGTGCCGGG - Intronic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1058932918 9:109739794-109739816 TTGGGTGTCTAGAGAGGGCCAGG - Intronic
1059950919 9:119461684-119461706 TAGGGTCTCAAGAAGGGGTCTGG - Intergenic
1061323687 9:129849097-129849119 TGGCATGTGTGGAAGGGGCCAGG + Intronic
1061760638 9:132848735-132848757 TCGGGTGTGGGGAAGGGTCCTGG + Intronic
1062464757 9:136676052-136676074 TAGGGTGTCTGGGAGAGGCCAGG - Intronic
1187713468 X:22077497-22077519 TAGGATGTGTAGCAGTGGCTTGG - Exonic
1189426688 X:40908112-40908134 TAGGGTTTGTAGAAGGTTCAAGG + Intergenic
1189738492 X:44095288-44095310 TAGGGTGTGTAGCAGCATCCTGG + Intergenic
1190122386 X:47672714-47672736 TAGGGTGTGTCTAAAGTGCCTGG + Intergenic
1190304818 X:49075947-49075969 TAGGGTGTGAAGATGGGGGGTGG + Intronic
1190354289 X:49589940-49589962 CAGGCGGTGAAGAAGGGGCCTGG + Intronic
1190396301 X:49988527-49988549 TAGGGTGTGTATAGAGAGCCGGG - Intronic
1196111107 X:111948262-111948284 AGGGGTGTTTAGAAGGGGCTAGG + Intronic
1197375601 X:125678409-125678431 CAGGGTCTGTAGAGTGGGCCTGG + Intergenic
1197800428 X:130341918-130341940 CAGGGTGTGTAGCATTGGCCAGG + Intronic
1199894478 X:152117583-152117605 TAGGGTGTGGGGATGGGGCTGGG + Intergenic
1201522328 Y:14889020-14889042 TAAGGTGTAAAGAAGGGGTCCGG + Intergenic
1201769399 Y:17604390-17604412 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1201832155 Y:18301595-18301617 TATGGTGTAAAGAAGGGGTCTGG + Intergenic