ID: 1136025882

View in Genome Browser
Species Human (GRCh38)
Location 16:27468961-27468983
Sequence GGCCGCCCGTGGAGAGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136025877_1136025882 -8 Left 1136025877 16:27468946-27468968 CCCGGGCAGTGACAGGGCCGCCC 0: 1
1: 0
2: 2
3: 20
4: 242
Right 1136025882 16:27468961-27468983 GGCCGCCCGTGGAGAGTGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 170
1136025878_1136025882 -9 Left 1136025878 16:27468947-27468969 CCGGGCAGTGACAGGGCCGCCCG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1136025882 16:27468961-27468983 GGCCGCCCGTGGAGAGTGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 170
1136025874_1136025882 6 Left 1136025874 16:27468932-27468954 CCAGGAGACTAGAGCCCGGGCAG 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1136025882 16:27468961-27468983 GGCCGCCCGTGGAGAGTGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136025882 Original CRISPR GGCCGCCCGTGGAGAGTGGG CGG Intronic