ID: 1136025954

View in Genome Browser
Species Human (GRCh38)
Location 16:27469286-27469308
Sequence CTCACCAGCGGGCCTGAGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136025944_1136025954 7 Left 1136025944 16:27469256-27469278 CCAGGCCCTCCCACAGCACCAGC 0: 1
1: 0
2: 8
3: 110
4: 758
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1136025947_1136025954 1 Left 1136025947 16:27469262-27469284 CCTCCCACAGCACCAGCAGGAGC 0: 1
1: 0
2: 8
3: 67
4: 571
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1136025948_1136025954 -2 Left 1136025948 16:27469265-27469287 CCCACAGCACCAGCAGGAGCACT 0: 1
1: 0
2: 2
3: 28
4: 329
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1136025943_1136025954 24 Left 1136025943 16:27469239-27469261 CCTGGATGATGGCGAGGCCAGGC 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1136025949_1136025954 -3 Left 1136025949 16:27469266-27469288 CCACAGCACCAGCAGGAGCACTC 0: 1
1: 0
2: 1
3: 28
4: 298
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192
1136025946_1136025954 2 Left 1136025946 16:27469261-27469283 CCCTCCCACAGCACCAGCAGGAG 0: 1
1: 1
2: 1
3: 53
4: 408
Right 1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG 0: 1
1: 0
2: 2
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136025954 Original CRISPR CTCACCAGCGGGCCTGAGCC GGG Exonic
900227617 1:1540397-1540419 CTCAGCATCGGGCCGGGGCCGGG - Intronic
900339169 1:2179734-2179756 CCCACCAGCAGCCCTGGGCCCGG - Intronic
901056573 1:6451215-6451237 CACCCCAGCCGGGCTGAGCCAGG + Intronic
901875504 1:12165032-12165054 CTCACCCCTGGGCCTGACCCTGG + Intergenic
902331429 1:15732866-15732888 CTCACCCCCGGGGCTGAGGCAGG - Intronic
903193516 1:21669249-21669271 CTCACCCAAGGGCCTGGGCCGGG + Intronic
906495420 1:46301833-46301855 CTCCCCAGCAGGCCTCGGCCGGG + Intronic
906636106 1:47411801-47411823 GACTCCAGAGGGCCTGAGCCAGG - Intergenic
912533734 1:110346962-110346984 CTCACCACAGTGCCTGAGTCGGG + Intergenic
917794154 1:178520916-178520938 GTCACCAGGGAGCCGGAGCCAGG - Intronic
917797955 1:178545375-178545397 CTCAGCAGCTGTCCTGGGCCTGG - Intronic
920231022 1:204469612-204469634 CTCATCAGCTGGGATGAGCCTGG - Exonic
921471628 1:215557041-215557063 CTCACCAGGGGGCCTAAGGATGG - Intergenic
924502869 1:244653213-244653235 CGCTTCAGGGGGCCTGAGCCGGG - Exonic
924628846 1:245718234-245718256 ATCAGTAGGGGGCCTGAGCCAGG - Intergenic
1062834942 10:629349-629371 CTCACCCGTGGTCCTGAGGCAGG + Intronic
1062840626 10:667325-667347 CTCCCCAGGAGGCCTCAGCCAGG - Intronic
1066998872 10:42587719-42587741 CTCGCCAGTGTGCCTGAGCATGG - Intronic
1067747164 10:48944464-48944486 CTCTCCAGATGGCCAGAGCCCGG - Intronic
1069625912 10:69867555-69867577 GTCCCCAGCAGGGCTGAGCCTGG + Intronic
1069694445 10:70376578-70376600 CTCACAAAAGGGCCTGAGCCTGG + Exonic
1070282229 10:75058284-75058306 CTCCCAAGCGAGCCTGGGCCTGG + Intronic
1070395872 10:76010831-76010853 CTCTGCAGAGGGCCTGAGACAGG - Intronic
1072413876 10:95230993-95231015 CTCGCCAGCAGAGCTGAGCCTGG + Intergenic
1072706122 10:97682272-97682294 CTCCCCAGCAGGCCTGGGGCTGG - Intronic
1072731399 10:97849661-97849683 CTCACCTGCGGGCCTGCGAGCGG + Intergenic
1073190040 10:101644574-101644596 CTCTCCAGAGGGCCTGGGGCTGG + Intronic
1074529366 10:114286526-114286548 CTGACCAGCGGTCCTGGGTCAGG - Intronic
1075897403 10:126008979-126009001 CACAGCAGGGGGCATGAGCCTGG - Intronic
1076498299 10:130914001-130914023 CTCCCCAGGGAGCCTGGGCCTGG - Intergenic
1076512848 10:131024790-131024812 CTCTCCTGGGGGCCTGGGCCGGG + Intergenic
1076782860 10:132734044-132734066 TTCACCAGCTGCACTGAGCCTGG - Intronic
1076827570 10:132977001-132977023 CCCACCTGCTGGCCTGAGACGGG - Intergenic
1076904158 10:133354103-133354125 CTCATCTGTGGGGCTGAGCCTGG + Intergenic
1077339093 11:2018095-2018117 CTCACCAGGGTGTCTGGGCCAGG + Intergenic
1077413095 11:2412596-2412618 GTCACCAGCGGCCATGATCCTGG - Intronic
1078145441 11:8719028-8719050 CTCAGCAGCAGGATTGAGCCTGG + Intronic
1080140295 11:28910259-28910281 GACACCAGAGGGACTGAGCCAGG - Intergenic
1083462345 11:62822541-62822563 GTCACCTGCGGGCCTTTGCCAGG + Intronic
1084431817 11:69115529-69115551 CTCACCAGCGGTCAGCAGCCGGG + Intergenic
1084658152 11:70531388-70531410 CGCGCCCGGGGGCCTGAGCCTGG + Intronic
1085792761 11:79510188-79510210 CTCTACAGCAGGCCGGAGCCAGG - Intergenic
1087259753 11:95997755-95997777 CTCACCAGTGGGCCTTAGAGTGG - Intronic
1089324416 11:117647552-117647574 CTCACTATCAGGCCTCAGCCTGG - Intronic
1090621774 11:128566969-128566991 CTCACCAGAGGGCCTGAAGGTGG + Intronic
1091237615 11:134032652-134032674 CTCGGCAGCCGGCCTTAGCCTGG + Intergenic
1202822077 11_KI270721v1_random:73277-73299 CTCACCAGGGTGTCTGGGCCAGG + Intergenic
1091447719 12:553563-553585 GTCACCAGCGGGCCTGGGCCTGG - Exonic
1091971722 12:4793090-4793112 CTCACCAGCTGCCCTGTGCAGGG + Intronic
1093915435 12:24797113-24797135 CTCAGCAGCGGGGCAGAACCAGG + Intergenic
1094031532 12:26017516-26017538 CTTTCCAGTGAGCCTGAGCCAGG - Intronic
1095969857 12:47894248-47894270 CCCCCCAGCTGCCCTGAGCCAGG + Intronic
1096180751 12:49549242-49549264 CTCCCCGGAGGGCCTGAGGCCGG + Intronic
1096626210 12:52897604-52897626 CTCACCAGGTGGTCTGAGCTCGG - Exonic
1096695244 12:53344750-53344772 ATCCCCGGCGGCCCTGAGCCTGG - Intronic
1102502265 12:113360521-113360543 CACAGCAGAGGGGCTGAGCCTGG - Intronic
1104019124 12:124980200-124980222 CTGACCAGCGGGCCTGGCCTGGG - Intronic
1104376486 12:128268166-128268188 CTCACCAGCGGTCCTGTCCGGGG + Intronic
1104409248 12:128544145-128544167 CGCACCAGCCGGCCTGGGCCCGG - Intronic
1104760203 12:131293601-131293623 CTCACCAGCAGGCCTTTCCCAGG - Intergenic
1104819567 12:131667045-131667067 CTCACCAGCAGGCCTTTCCCAGG + Intergenic
1104903585 12:132201980-132202002 CTCCCCACAAGGCCTGAGCCTGG - Intronic
1105323307 13:19347585-19347607 CTCAACAGCAGGGCTGACCCTGG - Intergenic
1106415698 13:29544013-29544035 CACAGCATCGGGCCTCAGCCAGG + Intronic
1107656003 13:42592551-42592573 CTCAACAGTGGGCTTGAGCCAGG - Intronic
1110010324 13:70325228-70325250 CTCAGCAGCTGGCAAGAGCCAGG + Intergenic
1113431159 13:110251372-110251394 AGCACCAGCAGGCCTGTGCCAGG + Intronic
1121671023 14:95710837-95710859 TTCACCCCAGGGCCTGAGCCTGG - Exonic
1122687680 14:103517826-103517848 CTCAGAAGTGGTCCTGAGCCAGG + Intergenic
1122798670 14:104218955-104218977 CTCACCAGCGGGGCTGAGATTGG - Intergenic
1124119214 15:26874877-26874899 TTCACCAGCGGTCCTGAAACAGG - Intronic
1125726072 15:41868714-41868736 CTCACCCGAGGCCCTGACCCAGG - Intronic
1132595571 16:747715-747737 CTTCCCAGAGGGCCAGAGCCAGG + Intronic
1132996768 16:2827486-2827508 CTCACCTGCGTGCCTGACCTGGG - Intergenic
1133220696 16:4317988-4318010 CTCCCCAGGGGGCCTGGGCCAGG - Intronic
1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG + Exonic
1140457430 16:75113417-75113439 CTCAACAACGGGGCTGGGCCTGG - Intronic
1141177292 16:81729547-81729569 CTCACCTGCGAGCCTAGGCCTGG + Intergenic
1141438258 16:84013171-84013193 CTCTCCAGGGGGCCTGAGCCAGG - Intronic
1142408763 16:89905601-89905623 CTCCCAGGCGGTCCTGAGCCTGG - Intronic
1143251360 17:5525543-5525565 CTCAACAGCTCACCTGAGCCTGG - Intronic
1143524863 17:7466166-7466188 CTCCCCAGCTGGCCTGGGCCCGG + Exonic
1143949920 17:10624264-10624286 CTCCCCACCGGGCCTTTGCCAGG + Intergenic
1144340843 17:14309398-14309420 CTCACCTGTTGGGCTGAGCCTGG + Intronic
1146578194 17:34013048-34013070 CTCTCCAGGGGGGTTGAGCCAGG - Intronic
1147980093 17:44268840-44268862 CTGGCCTGGGGGCCTGAGCCAGG - Intergenic
1149470718 17:56913409-56913431 CTCTCCCGCGTCCCTGAGCCAGG - Exonic
1149564206 17:57629983-57630005 CTCATCAGAGGGCCTGCCCCGGG + Intronic
1150108143 17:62477722-62477744 TTCACCGGCGCCCCTGAGCCAGG - Intronic
1151422830 17:74009725-74009747 CTCACCAGGGGACTTGACCCTGG + Intergenic
1152642336 17:81454465-81454487 CTCCTGAGAGGGCCTGAGCCCGG + Intronic
1152754425 17:82081296-82081318 CTCACTGGCGGACCTGGGCCTGG - Exonic
1152829947 17:82491054-82491076 CTCACCAGCAGGCACGGGCCAGG - Intergenic
1152829966 17:82491126-82491148 ATCACCAGCGGGCACGGGCCGGG - Intergenic
1152829982 17:82491175-82491197 CTCACTAGTGGGCATGGGCCGGG - Intergenic
1157727502 18:49976097-49976119 CTTTCCAGCAGGCTTGAGCCTGG - Intronic
1160508159 18:79438695-79438717 CTCACCCGCGCGGCTGAGGCAGG - Intronic
1161648686 19:5470666-5470688 CCCAACAGCAGGGCTGAGCCTGG + Intergenic
1161809631 19:6464536-6464558 CTCTCCTGTGGGCCTGCGCCGGG + Intronic
1162110772 19:8398507-8398529 CTCAGCAGGGGACCTGACCCTGG + Intronic
1162765881 19:12919146-12919168 ATCTCCAGCGGACCCGAGCCCGG - Intronic
1162951546 19:14074345-14074367 CTCACCAGCTGGCGGCAGCCAGG - Intronic
1163103472 19:15110493-15110515 GACACAAGGGGGCCTGAGCCGGG - Intronic
1163329334 19:16627060-16627082 CTCACCTGGGGGTCTCAGCCTGG - Intronic
1163411395 19:17157070-17157092 ATAGCCAGCGGCCCTGAGCCAGG - Intronic
1163701483 19:18788821-18788843 CTCCCCAGCGGGCCTTACCCGGG + Exonic
1165176290 19:33932592-33932614 CTCAGCAGCAGATCTGAGCCTGG - Intergenic
1166266056 19:41685199-41685221 CTCACCAGGGGGCCAGAGGCAGG - Intronic
1167749608 19:51371821-51371843 CTCCCCAGGTGCCCTGAGCCTGG - Exonic
1168403109 19:56097486-56097508 CTCCACTGCGGGCCTCAGCCCGG + Intronic
925280727 2:2682842-2682864 CTCACCACCAGGCCTGGGCTTGG - Intergenic
925637178 2:5951604-5951626 AACACCAGCTAGCCTGAGCCGGG - Intergenic
926246143 2:11123564-11123586 CTCACCGGAGGGCCAGGGCCAGG + Intergenic
931851669 2:66257883-66257905 CTTACAAGCAGGCCTCAGCCTGG + Intergenic
933585743 2:84177864-84177886 CTCAGCAGCAGGCCTGGCCCTGG + Intergenic
935271104 2:101435152-101435174 CTGCCTGGCGGGCCTGAGCCTGG - Intronic
936021548 2:108998835-108998857 GCCACCTGGGGGCCTGAGCCAGG - Intergenic
937353570 2:121184363-121184385 CTCACCAGATGGCCTGCACCAGG + Intergenic
937988504 2:127649487-127649509 GTCACCAGCGGGCTTCGGCCAGG - Intronic
946302110 2:218830356-218830378 CTCAGCAGCTGGCCTGGACCGGG + Exonic
947597597 2:231423265-231423287 CTGGGCAGCTGGCCTGAGCCTGG + Intergenic
947636111 2:231681371-231681393 GCCACAAGCGGGCCTGTGCCTGG - Intergenic
1172010743 20:31844493-31844515 CTCACCCTCCGGGCTGAGCCTGG - Exonic
1173335646 20:42110426-42110448 TTCACCAGCTGGCCTGACCACGG - Exonic
1174159686 20:48541989-48542011 CTCCACTGCGAGCCTGAGCCTGG - Intergenic
1174565446 20:51461382-51461404 TTCACCCGCAGGCCTGAGCCAGG - Intronic
1175235499 20:57507728-57507750 CTCAGGAGTGGCCCTGAGCCAGG + Intronic
1175249403 20:57600057-57600079 TTCACCATTGTGCCTGAGCCTGG + Intergenic
1175316910 20:58054999-58055021 CCCACGAGCTGGGCTGAGCCTGG - Intergenic
1175394844 20:58651011-58651033 CCAACGAGCAGGCCTGAGCCTGG - Intergenic
1178355252 21:31905909-31905931 GTCACTAGCGGGCCTGGGGCTGG + Intronic
1179806986 21:43845620-43845642 CTCACAAGAGACCCTGAGCCAGG + Intergenic
1179980191 21:44891600-44891622 CTCACCCGTGCTCCTGAGCCAGG - Intronic
1179994584 21:44968051-44968073 CAAGCCAGCGGGCCTGGGCCTGG + Intronic
1182328381 22:29531647-29531669 CTGACCAGCTGGCCTAAGGCTGG - Intronic
1183301170 22:37059903-37059925 GTCCCCAGCTGGCCTGAGCCAGG + Intronic
1183401400 22:37607170-37607192 CTCTCCAGCGGTCCTGTGCCTGG - Intergenic
1183484417 22:38081668-38081690 CTCGCCCGCAGGCCTGGGCCTGG - Exonic
1183633618 22:39047722-39047744 CTCAGCAGGGGGCCTGGGCTGGG - Intronic
1184034089 22:41910403-41910425 CTCACCTGCGGCCTTGAGCGCGG + Exonic
1184160094 22:42692762-42692784 CTCAACAGCCTGCCTAAGCCCGG + Exonic
1184445983 22:44547173-44547195 CTCAGCCAAGGGCCTGAGCCCGG - Intergenic
1185005730 22:48275744-48275766 CTCTCCAGCCTGCCTGGGCCAGG - Intergenic
1185199372 22:49492177-49492199 CCCACCTGGGGGCCTGAGCAAGG - Intronic
1185384600 22:50526062-50526084 CTCCCCAGCGCGGCTGCGCCCGG + Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949735354 3:7165315-7165337 CCCACCAGGGGGCCAGAGGCTGG - Intronic
952885363 3:38008481-38008503 CCCACCAGGGCCCCTGAGCCAGG + Exonic
952931522 3:38364534-38364556 CTAAGCAGTGGGCCTGAGGCTGG - Intronic
954434214 3:50487415-50487437 CCCACCAGGGAGCCTGAGCCAGG + Intronic
954653049 3:52176998-52177020 CTCTCCAGCAGGATTGAGCCCGG - Intergenic
968698636 4:2044380-2044402 CCCACCTGCAGCCCTGAGCCTGG + Intergenic
968933970 4:3600325-3600347 TTCACCTGCGGGCATGAGGCTGG - Intergenic
969615073 4:8247468-8247490 CTCCCCAGAGGGGCTGGGCCTGG - Intergenic
969858767 4:10019911-10019933 CTGACAAGCTGGCATGAGCCAGG + Intronic
977693792 4:99946296-99946318 CTCCCCACCGGGCCTGGGGCTGG + Intronic
979810017 4:125025713-125025735 CACACCAGTGTGCCTGAGCAGGG - Intergenic
979828344 4:125268468-125268490 CTCTCCAGCGTGCCTGACCTGGG + Intergenic
981087786 4:140701602-140701624 CCCACCAGCAGGCCTGAGGGTGG + Exonic
981331342 4:143513762-143513784 CTCCGCGACGGGCCTGAGCCGGG - Exonic
986737506 5:10678981-10679003 CCCAGCAGCTGGCCTGTGCCAGG - Intergenic
988489619 5:31695266-31695288 CTCCTCAGCAGCCCTGAGCCGGG - Intronic
992487475 5:77210526-77210548 CGCACCCGCGGCCCTGGGCCAGG - Intronic
992820253 5:80488544-80488566 CTCAGCAGCGGGACTATGCCGGG - Intronic
995903385 5:117094576-117094598 CTCACCAGCAGGCCCGAGTGTGG + Intergenic
999248898 5:150169904-150169926 CACACAAGCGGGGCTGAGCTGGG + Intronic
1001241638 5:170075891-170075913 CTGACCGGTGGGCCTCAGCCTGG - Intronic
1001541428 5:172542622-172542644 GTCACCAGCACGCCTGAGTCAGG - Intergenic
1004716886 6:18226581-18226603 CTCACCAGGTTGCCTGAGGCTGG - Intronic
1005922898 6:30416943-30416965 CTCACCAGCGTGCATCAGCGTGG + Intergenic
1007239244 6:40413379-40413401 CTCAGCACTGGGCCTGGGCCTGG + Intronic
1007730987 6:43946303-43946325 CTCACAAGCCTGGCTGAGCCAGG + Intergenic
1012436464 6:99220029-99220051 CTGACCAGCTGGCCTCTGCCAGG + Intergenic
1015732748 6:136364862-136364884 CTCATGAGCGGTCCTGAGCAGGG + Intronic
1016499085 6:144698669-144698691 CCCACCAGTGGGCCTGAGGCTGG + Intronic
1018085923 6:160300952-160300974 CACACCATCGGGGCTCAGCCAGG + Intergenic
1018660926 6:166086931-166086953 CTCACTAGCTGAACTGAGCCAGG - Intergenic
1019214677 6:170435474-170435496 CTGACAGCCGGGCCTGAGCCTGG - Intergenic
1019434804 7:1017172-1017194 TTCCCCAGGGAGCCTGAGCCTGG - Intronic
1019578857 7:1750323-1750345 CTCCCCTGCTGCCCTGAGCCGGG - Intergenic
1020271689 7:6600368-6600390 CGCACCAGGAGGCCTGGGCCAGG - Intronic
1022243191 7:28532304-28532326 CTCATAAGAGTGCCTGAGCCAGG + Intronic
1022480720 7:30741430-30741452 CTGACCAGCAGGGCAGAGCCGGG - Intronic
1024303056 7:47902707-47902729 CTCCCCAGCTAGCCTGGGCCAGG + Intronic
1025958540 7:66201021-66201043 CTCACCAGAGAGCATCAGCCAGG - Intergenic
1027184984 7:75965677-75965699 CTCAGCAGTGACCCTGAGCCAGG - Intronic
1028782916 7:94757554-94757576 CTAACCAGAGGTCCTGAGTCTGG + Intergenic
1030332087 7:108281749-108281771 CATGCCAGCAGGCCTGAGCCGGG + Intronic
1034527291 7:151673357-151673379 GTCACCTGCTGGGCTGAGCCTGG - Intronic
1035422202 7:158739142-158739164 GTCACCAGCTTGCCTGAGACTGG + Intronic
1038333686 8:26629582-26629604 CTCATCCTCGGGCCTGTGCCAGG - Intronic
1038486174 8:27936682-27936704 CTCACCAGTGTGCCAGAGACAGG - Intronic
1049433269 8:142575008-142575030 CTCAGCTGCGCACCTGAGCCGGG - Intergenic
1049570256 8:143366982-143367004 CTTACCTGTGGGCCTGAGCATGG - Intergenic
1049574498 8:143384077-143384099 CTCCCCAACCTGCCTGAGCCGGG + Exonic
1053153456 9:35757180-35757202 CTCACCAGAGGGCCAGCGGCCGG - Exonic
1057225300 9:93289672-93289694 CCCACCCCCGGGCCTGCGCCCGG - Intronic
1057828461 9:98389166-98389188 CTCAACAGGGAGCCTGAGCTAGG + Intronic
1061028973 9:128068305-128068327 CTCACCATCGGGCGCGAGGCAGG - Exonic
1061707436 9:132463744-132463766 TTCAGAAGCAGGCCTGAGCCTGG + Intronic
1061782489 9:133004216-133004238 CTCCCCAGCGCCCCTCAGCCCGG + Intergenic
1062006196 9:134239692-134239714 CTGCCCAGCTGGCCGGAGCCAGG + Intergenic
1062377246 9:136267743-136267765 CTCACCACCAGCCCTGATCCAGG + Intergenic
1062419346 9:136472276-136472298 CTCTCCAGCAGGACTGAGCGTGG + Intronic
1185507676 X:642520-642542 CTCTCCTTCGGGCCTGGGCCAGG - Intronic
1187154787 X:16712544-16712566 CTCACCAGCGTGAGTGAGCTGGG - Intronic
1190406706 X:50095436-50095458 CTCCACAGCTGGGCTGAGCCAGG - Exonic
1198254712 X:134914919-134914941 CACACCAGCTGGCCAGACCCTGG + Intronic