ID: 1136026211

View in Genome Browser
Species Human (GRCh38)
Location 16:27470641-27470663
Sequence GTGGCCTCACCTGGCGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136026207_1136026211 0 Left 1136026207 16:27470618-27470640 CCTGTCTCCTCATCTAATTCAAT 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1136026201_1136026211 30 Left 1136026201 16:27470588-27470610 CCGCTTGCCTGAGTACCTTCCGG 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1136026206_1136026211 11 Left 1136026206 16:27470607-27470629 CCGGGCAGAGTCCTGTCTCCTCA 0: 1
1: 1
2: 2
3: 29
4: 258
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1136026204_1136026211 23 Left 1136026204 16:27470595-27470617 CCTGAGTACCTTCCGGGCAGAGT 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1136026209_1136026211 -7 Left 1136026209 16:27470625-27470647 CCTCATCTAATTCAATGTGGCCT 0: 1
1: 0
2: 1
3: 18
4: 138
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1136026205_1136026211 15 Left 1136026205 16:27470603-27470625 CCTTCCGGGCAGAGTCCTGTCTC 0: 1
1: 0
2: 2
3: 9
4: 186
Right 1136026211 16:27470641-27470663 GTGGCCTCACCTGGCGCTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136026211 Original CRISPR GTGGCCTCACCTGGCGCTCC AGG Intronic